Mutagenetix > Incidental Mutation

Incidental Mutation 'R0815:Capn7'

78586

Institutional Source

Beutler Lab

Gene Symbol

Capn7

Ensembl Gene

ENSMUSG00000021893

Gene Name

calpain 7

Synonyms

PalBH

MMRRC Submission

038995-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.803) question?

Stock #

R0815 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31336638-31371986 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 31369757 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 704 (C704S)

Ref Sequence

ENSEMBL: ENSMUSP00000022451 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022451] [ENSMUST00000091903] [ENSMUST00000100730] [ENSMUST00000140002] [ENSMUST00000143472] [ENSMUST00000152182]

AlphaFold

Q9R1S8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022451
AA Change: C704S

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000022451
Gene: ENSMUSG00000021893
AA Change: C704S

Domain	Start	End	E-Value	Type
MIT	3	77	1.54e0	SMART
MIT	83	160	1.07e-17	SMART
CysPc	218	547	1.08e-91	SMART
Blast:CysPc	550	620	4e-39	BLAST
calpain_III	686	810	2.78e-39	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000091903

SMART Domains

Protein: ENSMUSP00000089517
Gene: ENSMUSG00000021892

Domain	Start	End	E-Value	Type
Pfam:SH3BP5	42	272	2.2e-99	PFAM
low complexity region	323	335	N/A	INTRINSIC
low complexity region	407	428	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100730

SMART Domains

Protein: ENSMUSP00000098296
Gene: ENSMUSG00000021892

Domain	Start	End	E-Value	Type
Pfam:SH3BP5	60	274	5.5e-95	PFAM
low complexity region	321	333	N/A	INTRINSIC
low complexity region	405	426	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140002

SMART Domains

Protein: ENSMUSP00000117152
Gene: ENSMUSG00000021892

Domain	Start	End	E-Value	Type
Pfam:SH3BP5	42	272	2.3e-99	PFAM
low complexity region	323	335	N/A	INTRINSIC
low complexity region	407	428	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143472

SMART Domains

Protein: ENSMUSP00000118596
Gene: ENSMUSG00000021893

Domain	Start	End	E-Value	Type
MIT	3	77	1.54e0	SMART
MIT	83	160	1.07e-17	SMART
CysPc	218	500	2.32e-50	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000152182

SMART Domains

Protein: ENSMUSP00000119214
Gene: ENSMUSG00000021893

Domain	Start	End	E-Value	Type
MIT	3	77	1.54e0	SMART
MIT	83	160	1.07e-17	SMART
CysPc	218	500	2.32e-50	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228237

Meta Mutation Damage Score

0.3475

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.5%
20x: 91.3%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The function of the protein encoded by this gene is not known. An orthologue has been found in mouse but it seems to diverge from other family members. The mouse orthologue is thought to be calcium independent with protease activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene frequently die before weaning. Survivors display reduced body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	A	T	9: 92,351,087	I88L	possibly damaging	Het
Abcb5	A	G	12: 118,901,449		probably benign	Het
Abcf2	A	T	5: 24,567,270	Y487N	probably damaging	Het
Adcy4	T	C	14: 55,783,599	Y27C	probably damaging	Het
Atp2a2	T	C	5: 122,471,236	I188V	probably benign	Het
Cacna1s	A	T	1: 136,112,957	I1231F	possibly damaging	Het
Celsr2	G	T	3: 108,401,301	T1770K	possibly damaging	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Cul9	T	C	17: 46,537,822		probably null	Het
Dpp10	A	G	1: 123,432,929		probably null	Het
Dscaml1	A	G	9: 45,745,074	I1571V	probably benign	Het
Eif3j2	T	A	18: 43,476,971	Y259F	probably benign	Het
Erc2	A	C	14: 28,025,148	N345T	probably benign	Het
Fbxo21	T	C	5: 117,995,508		probably benign	Het
Frmd8	A	T	19: 5,865,056		probably benign	Het
Gfm1	T	C	3: 67,474,595	S705P	probably damaging	Het
Gucy1b2	T	C	14: 62,419,062	D282G	probably benign	Het
H2-Ab1	T	C	17: 34,267,354	I129T	probably damaging	Het
H2-M10.3	T	A	17: 36,366,690	Y232F	probably damaging	Het
Lipm	A	T	19: 34,118,761	T326S	probably benign	Het
Lrrc8c	T	C	5: 105,608,534	L725P	probably damaging	Het
Map3k19	A	G	1: 127,834,638		probably benign	Het
Med31	T	A	11: 72,213,831	N50I	probably damaging	Het
Mgea5	C	T	19: 45,782,986	A49T	probably benign	Het
Myo15b	T	G	11: 115,866,336		probably benign	Het
Nemp1	T	C	10: 127,693,024	L199S	probably damaging	Het
Nod2	G	A	8: 88,672,662		probably benign	Het
Olfr1444	A	G	19: 12,862,644	I290V	probably benign	Het
Olfr319	A	G	11: 58,702,609	R303G	possibly damaging	Het
Parva	G	A	7: 112,567,864	V215M	probably damaging	Het
Phf1	T	C	17: 26,937,140		probably benign	Het
Ppp1r12c	G	T	7: 4,486,366	Q240K	probably damaging	Het
Ralgapa1	A	T	12: 55,762,681	Y436*	probably null	Het
Ralgapa1	C	A	12: 55,782,777		probably benign	Het
Rbm11	C	T	16: 75,596,637	R74C	probably damaging	Het
Robo3	A	G	9: 37,422,183	V744A	probably damaging	Het
Rsbn1	T	G	3: 103,954,153	S522A	probably damaging	Het
Scel	T	A	14: 103,586,480	S381R	possibly damaging	Het
Sec31b	G	A	19: 44,518,173	Q909*	probably null	Het
Slc38a11	T	A	2: 65,353,780	I176L	possibly damaging	Het
Slc39a4	C	T	15: 76,612,639	D574N	probably damaging	Het
Slc44a1	T	G	4: 53,536,421	V199G	possibly damaging	Het
Sltm	A	G	9: 70,561,908	T150A	probably benign	Het
Son	C	A	16: 91,655,484	A373D	probably damaging	Het
Sp140	C	T	1: 85,620,051		probably benign	Het
Speg	A	G	1: 75,415,392	Y1606C	probably damaging	Het
Srgap1	A	T	10: 121,785,474	V1061D	probably damaging	Het
Stat5a	A	G	11: 100,875,082		probably null	Het
Supt4a	T	A	11: 87,737,583		probably benign	Het
Teddm1b	A	G	1: 153,874,892	K149R	possibly damaging	Het
Thnsl2	A	T	6: 71,134,224	L220*	probably null	Het
Tinf2	G	A	14: 55,680,109	P308S	probably benign	Het
Tmem131l	A	G	3: 83,940,572	S329P	probably benign	Het
Tnf	T	C	17: 35,201,144		probably benign	Het
Upp2	A	G	2: 58,771,556	T144A	probably benign	Het
Vmn2r94	T	G	17: 18,257,711	Q146P	probably damaging	Het
Zfhx4	T	A	3: 5,245,315	S919R	possibly damaging	Het

Other mutations in Capn7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Capn7	APN	14	31363578	missense	probably benign	0.41
IGL01481:Capn7	APN	14	31355339	missense	probably damaging	1.00
IGL03231:Capn7	APN	14	31355290	missense	probably damaging	1.00
R0018:Capn7	UTSW	14	31354112	nonsense	probably null
R0018:Capn7	UTSW	14	31354112	nonsense	probably null
R0060:Capn7	UTSW	14	31365604	splice site	probably benign
R0060:Capn7	UTSW	14	31365604	splice site	probably benign
R0077:Capn7	UTSW	14	31368115	missense	probably benign	0.10
R0195:Capn7	UTSW	14	31365581	missense	probably damaging	1.00
R0316:Capn7	UTSW	14	31347809	missense	probably benign	0.00
R0863:Capn7	UTSW	14	31369757	missense	possibly damaging	0.85
R1697:Capn7	UTSW	14	31360160	missense	probably damaging	1.00
R1954:Capn7	UTSW	14	31360150	missense	probably damaging	1.00
R2096:Capn7	UTSW	14	31349887	critical splice donor site	probably null
R3121:Capn7	UTSW	14	31359210	missense	probably damaging	1.00
R3122:Capn7	UTSW	14	31359210	missense	probably damaging	1.00
R4409:Capn7	UTSW	14	31355339	missense	probably damaging	1.00
R4676:Capn7	UTSW	14	31359259	missense	possibly damaging	0.72
R4799:Capn7	UTSW	14	31360557	missense	probably benign	0.01
R5023:Capn7	UTSW	14	31352426	missense	probably damaging	0.99
R5129:Capn7	UTSW	14	31344511	missense	probably damaging	0.99
R5460:Capn7	UTSW	14	31368203	critical splice donor site	probably null
R5608:Capn7	UTSW	14	31370707	missense	probably damaging	1.00
R5665:Capn7	UTSW	14	31369802	missense	probably benign	0.00
R5786:Capn7	UTSW	14	31360145	missense	probably damaging	1.00
R6186:Capn7	UTSW	14	31370918	missense	probably damaging	1.00
R6190:Capn7	UTSW	14	31363603	missense	probably benign	0.10
R6411:Capn7	UTSW	14	31340096	missense	probably benign	0.00
R6514:Capn7	UTSW	14	31344554	missense	probably benign	0.00
R6838:Capn7	UTSW	14	31354173	missense	possibly damaging	0.95
R7041:Capn7	UTSW	14	31336685	unclassified	probably benign
R7047:Capn7	UTSW	14	31336685	unclassified	probably benign
R7124:Capn7	UTSW	14	31336685	unclassified	probably benign
R7224:Capn7	UTSW	14	31370721	nonsense	probably null
R7417:Capn7	UTSW	14	31370706	missense	probably damaging	1.00
R7419:Capn7	UTSW	14	31349822	missense	probably benign	0.02
R7544:Capn7	UTSW	14	31340050	missense	probably damaging	1.00
R7699:Capn7	UTSW	14	31352444	missense	probably benign	0.00
R7700:Capn7	UTSW	14	31352444	missense	probably benign	0.00
R7775:Capn7	UTSW	14	31352410	missense	probably benign	0.00
R7824:Capn7	UTSW	14	31352410	missense	probably benign	0.00
R7908:Capn7	UTSW	14	31366245	critical splice donor site	probably null
R8057:Capn7	UTSW	14	31370979	missense	probably benign	0.27
R8176:Capn7	UTSW	14	31347772	missense	probably benign	0.03
R8270:Capn7	UTSW	14	31358679	missense	probably damaging	0.97
R9103:Capn7	UTSW	14	31369775	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- GCTTGCAGTGTGGGTAAAACAGATG -3'
(R):5'- AGCTTAGGACAAAGCTCAGTGGC -3'

Sequencing Primer
(F):5'- GAAGATTCCTGAGAGAATTTCTGGC -3'
(R):5'- GGTCCTCTCAGCTCAATCAA -3'

Posted On

2013-10-16