Incidental Mutation 'R0815:Adcy4'
ID78588
Institutional Source Beutler Lab
Gene Symbol Adcy4
Ensembl Gene ENSMUSG00000022220
Gene Nameadenylate cyclase 4
Synonyms
MMRRC Submission 038995-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0815 (G1)
Quality Score206
Status Validated
Chromosome14
Chromosomal Location55769057-55784095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55783599 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 27 (Y27C)
Ref Sequence ENSEMBL: ENSMUSP00000130530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000022830] [ENSMUST00000168716] [ENSMUST00000170223] [ENSMUST00000178399] [ENSMUST00000227031] [ENSMUST00000228326] [ENSMUST00000228476]
Predicted Effect probably damaging
Transcript: ENSMUST00000002398
AA Change: Y27C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220
AA Change: Y27C

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 2.4e-35 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022830
SMART Domains Protein: ENSMUSP00000022830
Gene: ENSMUSG00000022221

DomainStartEndE-ValueType
Pfam:Pkinase 22 288 2.8e-38 PFAM
Pfam:Pkinase_Tyr 22 288 3e-34 PFAM
Pfam:RHIM 408 458 2.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168716
SMART Domains Protein: ENSMUSP00000126306
Gene: ENSMUSG00000022221

DomainStartEndE-ValueType
Pfam:Pkinase 1 223 1.2e-30 PFAM
Pfam:Pkinase_Tyr 1 224 3.1e-27 PFAM
Pfam:RHIM 344 395 2.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170223
AA Change: Y27C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220
AA Change: Y27C

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 61 80 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 1.6e-24 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178399
SMART Domains Protein: ENSMUSP00000137278
Gene: ENSMUSG00000022221

DomainStartEndE-ValueType
Pfam:Pkinase 1 223 1.2e-30 PFAM
Pfam:Pkinase_Tyr 1 224 3.1e-27 PFAM
Pfam:RHIM 344 395 2.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226361
Predicted Effect probably damaging
Transcript: ENSMUST00000227031
AA Change: Y27C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228175
Predicted Effect probably benign
Transcript: ENSMUST00000228326
Predicted Effect probably benign
Transcript: ENSMUST00000228476
Meta Mutation Damage Score 0.2187 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). Mouse studies show that adenylate cyclase 4, along with adenylate cyclases 2 and 3, is expressed in olfactory cilia, suggesting that several different adenylate cyclases may couple to olfactory receptors and that there may be multiple receptor-mediated mechanisms for the generation of cAMP signals. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
Abcb5 A G 12: 118,901,449 probably benign Het
Abcf2 A T 5: 24,567,270 Y487N probably damaging Het
Atp2a2 T C 5: 122,471,236 I188V probably benign Het
Cacna1s A T 1: 136,112,957 I1231F possibly damaging Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Celsr2 G T 3: 108,401,301 T1770K possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Dpp10 A G 1: 123,432,929 probably null Het
Dscaml1 A G 9: 45,745,074 I1571V probably benign Het
Eif3j2 T A 18: 43,476,971 Y259F probably benign Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fbxo21 T C 5: 117,995,508 probably benign Het
Frmd8 A T 19: 5,865,056 probably benign Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Lipm A T 19: 34,118,761 T326S probably benign Het
Lrrc8c T C 5: 105,608,534 L725P probably damaging Het
Map3k19 A G 1: 127,834,638 probably benign Het
Med31 T A 11: 72,213,831 N50I probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Myo15b T G 11: 115,866,336 probably benign Het
Nemp1 T C 10: 127,693,024 L199S probably damaging Het
Nod2 G A 8: 88,672,662 probably benign Het
Olfr1444 A G 19: 12,862,644 I290V probably benign Het
Olfr319 A G 11: 58,702,609 R303G possibly damaging Het
Parva G A 7: 112,567,864 V215M probably damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Rbm11 C T 16: 75,596,637 R74C probably damaging Het
Robo3 A G 9: 37,422,183 V744A probably damaging Het
Rsbn1 T G 3: 103,954,153 S522A probably damaging Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sec31b G A 19: 44,518,173 Q909* probably null Het
Slc38a11 T A 2: 65,353,780 I176L possibly damaging Het
Slc39a4 C T 15: 76,612,639 D574N probably damaging Het
Slc44a1 T G 4: 53,536,421 V199G possibly damaging Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Son C A 16: 91,655,484 A373D probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Speg A G 1: 75,415,392 Y1606C probably damaging Het
Srgap1 A T 10: 121,785,474 V1061D probably damaging Het
Stat5a A G 11: 100,875,082 probably null Het
Supt4a T A 11: 87,737,583 probably benign Het
Teddm1b A G 1: 153,874,892 K149R possibly damaging Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Upp2 A G 2: 58,771,556 T144A probably benign Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Adcy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Adcy4 APN 14 55773663 splice site probably null
IGL02406:Adcy4 APN 14 55770047 missense possibly damaging 0.45
IGL02503:Adcy4 APN 14 55771505 missense probably damaging 1.00
IGL02543:Adcy4 APN 14 55769170 missense probably benign
IGL02616:Adcy4 APN 14 55783514 splice site probably null
IGL03002:Adcy4 APN 14 55773556 missense probably benign 0.31
IGL03026:Adcy4 APN 14 55778010 missense probably damaging 1.00
IGL03190:Adcy4 APN 14 55779053 missense probably damaging 1.00
IGL03247:Adcy4 APN 14 55770096 missense probably damaging 1.00
stressed UTSW 14 55779099 splice site probably null
IGL03098:Adcy4 UTSW 14 55781581 missense probably null 0.82
R0098:Adcy4 UTSW 14 55769827 missense possibly damaging 0.78
R0102:Adcy4 UTSW 14 55771533 missense probably benign 0.29
R0396:Adcy4 UTSW 14 55772288 missense probably benign 0.00
R0482:Adcy4 UTSW 14 55774572 critical splice acceptor site probably null
R0634:Adcy4 UTSW 14 55781597 missense probably benign
R0691:Adcy4 UTSW 14 55772647 splice site probably benign
R0704:Adcy4 UTSW 14 55772756 missense probably benign
R0863:Adcy4 UTSW 14 55783599 missense probably damaging 1.00
R1446:Adcy4 UTSW 14 55770023 critical splice donor site probably null
R1462:Adcy4 UTSW 14 55778308 missense possibly damaging 0.78
R1462:Adcy4 UTSW 14 55778308 missense possibly damaging 0.78
R1463:Adcy4 UTSW 14 55778939 missense probably damaging 1.00
R1624:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R1799:Adcy4 UTSW 14 55771472 missense probably benign 0.01
R1878:Adcy4 UTSW 14 55769905 missense probably damaging 0.96
R2007:Adcy4 UTSW 14 55778313 missense possibly damaging 0.45
R2156:Adcy4 UTSW 14 55769170 missense probably benign 0.09
R2425:Adcy4 UTSW 14 55778017 missense probably damaging 0.99
R2517:Adcy4 UTSW 14 55781946 missense probably damaging 1.00
R3882:Adcy4 UTSW 14 55774546 missense probably benign 0.27
R4021:Adcy4 UTSW 14 55775178 splice site probably null
R4022:Adcy4 UTSW 14 55775178 splice site probably null
R4411:Adcy4 UTSW 14 55769443 missense probably damaging 1.00
R4530:Adcy4 UTSW 14 55779028 missense probably damaging 1.00
R4560:Adcy4 UTSW 14 55778950 splice site probably null
R4704:Adcy4 UTSW 14 55775025 missense possibly damaging 0.91
R4780:Adcy4 UTSW 14 55775036 missense probably benign 0.07
R4860:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R4860:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R4868:Adcy4 UTSW 14 55773722 missense probably benign
R4890:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4920:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4948:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4952:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4953:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4987:Adcy4 UTSW 14 55773477 missense probably benign 0.01
R4991:Adcy4 UTSW 14 55773465 missense probably benign 0.03
R5080:Adcy4 UTSW 14 55772375 missense probably damaging 0.98
R5620:Adcy4 UTSW 14 55772367 nonsense probably null
R5652:Adcy4 UTSW 14 55773443 missense probably benign
R5726:Adcy4 UTSW 14 55783661 missense probably damaging 1.00
R5910:Adcy4 UTSW 14 55779013 missense probably damaging 1.00
R5958:Adcy4 UTSW 14 55779099 splice site probably null
R6280:Adcy4 UTSW 14 55779043 missense probably damaging 1.00
R6318:Adcy4 UTSW 14 55769224 missense probably damaging 1.00
R6598:Adcy4 UTSW 14 55770045 missense probably benign 0.03
R6947:Adcy4 UTSW 14 55778391 missense possibly damaging 0.92
R7012:Adcy4 UTSW 14 55779919 missense possibly damaging 0.95
R7147:Adcy4 UTSW 14 55779725 missense probably damaging 1.00
R7386:Adcy4 UTSW 14 55778327 missense probably damaging 1.00
R7414:Adcy4 UTSW 14 55781633 missense probably benign 0.15
R7431:Adcy4 UTSW 14 55772672 missense probably benign 0.01
R7490:Adcy4 UTSW 14 55770433 missense possibly damaging 0.66
R7552:Adcy4 UTSW 14 55773465 missense probably benign 0.00
R7672:Adcy4 UTSW 14 55780905 missense probably benign 0.14
R8003:Adcy4 UTSW 14 55781635 missense probably benign 0.00
R8042:Adcy4 UTSW 14 55775239 missense probably benign 0.01
R8100:Adcy4 UTSW 14 55772265 nonsense probably null
R8343:Adcy4 UTSW 14 55775240 missense probably benign 0.02
R8801:Adcy4 UTSW 14 55771995 missense not run
R8811:Adcy4 UTSW 14 55772764 missense not run
X0025:Adcy4 UTSW 14 55770391 missense probably damaging 1.00
Z1088:Adcy4 UTSW 14 55780956 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTCAGATCTTCAAATGTCCCCAGCC -3'
(R):5'- GGAGCCTAGCTTTGCTGAGAGAAC -3'

Sequencing Primer
(F):5'- ATGTCCCCAGCCCGAGG -3'
(R):5'- AGAACTTCTGGAGCTTGACC -3'
Posted On2013-10-16