Incidental Mutation 'R0815:Vmn2r94'
ID78594
Institutional Source Beutler Lab
Gene Symbol Vmn2r94
Ensembl Gene ENSMUSG00000090417
Gene Namevomeronasal 2, receptor 94
SynonymsEG665227
MMRRC Submission 038995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0815 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18240994-18277756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 18257711 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 146 (Q146P)
Ref Sequence ENSEMBL: ENSMUSP00000156288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172190] [ENSMUST00000231457] [ENSMUST00000231815]
Predicted Effect probably damaging
Transcript: ENSMUST00000172190
AA Change: Q146P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126386
Gene: ENSMUSG00000090417
AA Change: Q146P

DomainStartEndE-ValueType
Pfam:ANF_receptor 42 425 1.7e-35 PFAM
Pfam:NCD3G 469 522 3.5e-21 PFAM
Pfam:7tm_3 553 790 1.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231457
Predicted Effect probably damaging
Transcript: ENSMUST00000231815
AA Change: Q146P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
Abcb5 A G 12: 118,901,449 probably benign Het
Abcf2 A T 5: 24,567,270 Y487N probably damaging Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Atp2a2 T C 5: 122,471,236 I188V probably benign Het
Cacna1s A T 1: 136,112,957 I1231F possibly damaging Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Celsr2 G T 3: 108,401,301 T1770K possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Dpp10 A G 1: 123,432,929 probably null Het
Dscaml1 A G 9: 45,745,074 I1571V probably benign Het
Eif3j2 T A 18: 43,476,971 Y259F probably benign Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fbxo21 T C 5: 117,995,508 probably benign Het
Frmd8 A T 19: 5,865,056 probably benign Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Lipm A T 19: 34,118,761 T326S probably benign Het
Lrrc8c T C 5: 105,608,534 L725P probably damaging Het
Map3k19 A G 1: 127,834,638 probably benign Het
Med31 T A 11: 72,213,831 N50I probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Myo15b T G 11: 115,866,336 probably benign Het
Nemp1 T C 10: 127,693,024 L199S probably damaging Het
Nod2 G A 8: 88,672,662 probably benign Het
Olfr1444 A G 19: 12,862,644 I290V probably benign Het
Olfr319 A G 11: 58,702,609 R303G possibly damaging Het
Parva G A 7: 112,567,864 V215M probably damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Rbm11 C T 16: 75,596,637 R74C probably damaging Het
Robo3 A G 9: 37,422,183 V744A probably damaging Het
Rsbn1 T G 3: 103,954,153 S522A probably damaging Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sec31b G A 19: 44,518,173 Q909* probably null Het
Slc38a11 T A 2: 65,353,780 I176L possibly damaging Het
Slc39a4 C T 15: 76,612,639 D574N probably damaging Het
Slc44a1 T G 4: 53,536,421 V199G possibly damaging Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Son C A 16: 91,655,484 A373D probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Speg A G 1: 75,415,392 Y1606C probably damaging Het
Srgap1 A T 10: 121,785,474 V1061D probably damaging Het
Stat5a A G 11: 100,875,082 probably null Het
Supt4a T A 11: 87,737,583 probably benign Het
Teddm1b A G 1: 153,874,892 K149R possibly damaging Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Upp2 A G 2: 58,771,556 T144A probably benign Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Vmn2r94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Vmn2r94 APN 17 18257039 missense probably damaging 1.00
IGL01676:Vmn2r94 APN 17 18257010 missense probably benign
IGL01687:Vmn2r94 APN 17 18253312 missense possibly damaging 0.64
IGL02113:Vmn2r94 APN 17 18257675 missense probably damaging 0.99
IGL02408:Vmn2r94 APN 17 18253261 missense probably benign 0.01
IGL02451:Vmn2r94 APN 17 18258191 missense possibly damaging 0.95
IGL02755:Vmn2r94 APN 17 18244499 missense probably benign 0.01
IGL02822:Vmn2r94 APN 17 18243620 missense probably benign 0.00
IGL02868:Vmn2r94 APN 17 18244054 missense possibly damaging 0.75
IGL03008:Vmn2r94 APN 17 18257646 missense probably benign 0.05
R0112:Vmn2r94 UTSW 17 18243604 missense probably benign
R0371:Vmn2r94 UTSW 17 18257294 missense probably benign 0.11
R0413:Vmn2r94 UTSW 17 18243818 missense probably damaging 0.98
R0627:Vmn2r94 UTSW 17 18257165 missense probably damaging 1.00
R0737:Vmn2r94 UTSW 17 18277433 nonsense probably null
R0863:Vmn2r94 UTSW 17 18257711 missense probably damaging 1.00
R1125:Vmn2r94 UTSW 17 18257455 missense probably damaging 1.00
R1276:Vmn2r94 UTSW 17 18257082 missense possibly damaging 0.47
R1491:Vmn2r94 UTSW 17 18257703 missense probably damaging 1.00
R1500:Vmn2r94 UTSW 17 18256980 missense probably benign 0.07
R1610:Vmn2r94 UTSW 17 18243733 missense probably damaging 1.00
R1664:Vmn2r94 UTSW 17 18244144 missense probably damaging 0.99
R1716:Vmn2r94 UTSW 17 18257373 missense probably benign 0.01
R1843:Vmn2r94 UTSW 17 18244470 missense probably benign 0.01
R1882:Vmn2r94 UTSW 17 18244214 missense probably benign 0.07
R1936:Vmn2r94 UTSW 17 18244292 nonsense probably null
R2273:Vmn2r94 UTSW 17 18257331 missense probably benign 0.00
R2508:Vmn2r94 UTSW 17 18257474 missense probably benign 0.32
R3436:Vmn2r94 UTSW 17 18258388 splice site probably benign
R3917:Vmn2r94 UTSW 17 18244358 missense probably benign
R3968:Vmn2r94 UTSW 17 18258385 missense possibly damaging 0.95
R3969:Vmn2r94 UTSW 17 18258385 missense possibly damaging 0.95
R4257:Vmn2r94 UTSW 17 18244171 missense probably damaging 1.00
R4271:Vmn2r94 UTSW 17 18243678 missense probably damaging 1.00
R4349:Vmn2r94 UTSW 17 18244343 missense probably benign 0.01
R4436:Vmn2r94 UTSW 17 18258383 missense probably damaging 1.00
R4603:Vmn2r94 UTSW 17 18257385 missense probably benign 0.33
R4821:Vmn2r94 UTSW 17 18257031 missense probably benign 0.02
R5288:Vmn2r94 UTSW 17 18244466 missense probably damaging 1.00
R5725:Vmn2r94 UTSW 17 18256227 missense possibly damaging 0.88
R5735:Vmn2r94 UTSW 17 18243804 missense probably damaging 1.00
R6066:Vmn2r94 UTSW 17 18257433 missense probably damaging 0.99
R6124:Vmn2r94 UTSW 17 18244059 missense probably benign 0.01
R6189:Vmn2r94 UTSW 17 18257734 missense probably benign 0.25
R6245:Vmn2r94 UTSW 17 18258123 missense probably damaging 1.00
R6574:Vmn2r94 UTSW 17 18256159 missense probably damaging 1.00
R7236:Vmn2r94 UTSW 17 18257549 missense possibly damaging 0.49
R7317:Vmn2r94 UTSW 17 18243620 missense probably benign 0.00
R7398:Vmn2r94 UTSW 17 18257341 missense probably benign 0.00
R7399:Vmn2r94 UTSW 17 18244503 critical splice acceptor site probably null
R7478:Vmn2r94 UTSW 17 18257505 missense probably benign
RF014:Vmn2r94 UTSW 17 18253287 nonsense probably null
X0011:Vmn2r94 UTSW 17 18244448 missense possibly damaging 0.76
X0028:Vmn2r94 UTSW 17 18243975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCATGACCCAGACAATCCATGTCAA -3'
(R):5'- GCCCAAATTGGGACATTGCTTCAAC -3'

Sequencing Primer
(F):5'- CCAGAAGCTTGTAAAATATGCAGTCC -3'
(R):5'- CTGAGCAAGTCCTTGAAACTTAC -3'
Posted On2013-10-16