Incidental Mutation 'R0815:Lipm'
ID78603
Institutional Source Beutler Lab
Gene Symbol Lipm
Ensembl Gene ENSMUSG00000056078
Gene Namelipase, family member M
SynonymsLipl3, 4632427C23Rik
MMRRC Submission 038995-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R0815 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34100943-34122687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34118761 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 326 (T326S)
Ref Sequence ENSEMBL: ENSMUSP00000025685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025685] [ENSMUST00000025686]
Predicted Effect probably benign
Transcript: ENSMUST00000025685
AA Change: T326S

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025685
Gene: ENSMUSG00000056078
AA Change: T326S

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 49 111 3.3e-26 PFAM
Pfam:Abhydrolase_1 92 393 2.6e-29 PFAM
Pfam:Abhydrolase_5 93 387 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025686
SMART Domains Protein: ENSMUSP00000025686
Gene: ENSMUSG00000024774

DomainStartEndE-ValueType
ANK 39 68 1.1e-6 SMART
ANK 72 130 2.05e2 SMART
ANK 134 163 1.68e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160474
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
Abcb5 A G 12: 118,901,449 probably benign Het
Abcf2 A T 5: 24,567,270 Y487N probably damaging Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Atp2a2 T C 5: 122,471,236 I188V probably benign Het
Cacna1s A T 1: 136,112,957 I1231F possibly damaging Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Celsr2 G T 3: 108,401,301 T1770K possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Dpp10 A G 1: 123,432,929 probably null Het
Dscaml1 A G 9: 45,745,074 I1571V probably benign Het
Eif3j2 T A 18: 43,476,971 Y259F probably benign Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fbxo21 T C 5: 117,995,508 probably benign Het
Frmd8 A T 19: 5,865,056 probably benign Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Lrrc8c T C 5: 105,608,534 L725P probably damaging Het
Map3k19 A G 1: 127,834,638 probably benign Het
Med31 T A 11: 72,213,831 N50I probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Myo15b T G 11: 115,866,336 probably benign Het
Nemp1 T C 10: 127,693,024 L199S probably damaging Het
Nod2 G A 8: 88,672,662 probably benign Het
Olfr1444 A G 19: 12,862,644 I290V probably benign Het
Olfr319 A G 11: 58,702,609 R303G possibly damaging Het
Parva G A 7: 112,567,864 V215M probably damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Rbm11 C T 16: 75,596,637 R74C probably damaging Het
Robo3 A G 9: 37,422,183 V744A probably damaging Het
Rsbn1 T G 3: 103,954,153 S522A probably damaging Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sec31b G A 19: 44,518,173 Q909* probably null Het
Slc38a11 T A 2: 65,353,780 I176L possibly damaging Het
Slc39a4 C T 15: 76,612,639 D574N probably damaging Het
Slc44a1 T G 4: 53,536,421 V199G possibly damaging Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Son C A 16: 91,655,484 A373D probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Speg A G 1: 75,415,392 Y1606C probably damaging Het
Srgap1 A T 10: 121,785,474 V1061D probably damaging Het
Stat5a A G 11: 100,875,082 probably null Het
Supt4a T A 11: 87,737,583 probably benign Het
Teddm1b A G 1: 153,874,892 K149R possibly damaging Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Upp2 A G 2: 58,771,556 T144A probably benign Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Lipm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01624:Lipm APN 19 34121145 missense probably damaging 1.00
IGL01789:Lipm APN 19 34118747 missense probably damaging 1.00
IGL01878:Lipm APN 19 34116511 missense possibly damaging 0.63
IGL01897:Lipm APN 19 34121308 missense probably damaging 1.00
IGL02713:Lipm APN 19 34101170 start codon destroyed probably null 0.77
R0029:Lipm UTSW 19 34116548 splice site probably benign
R0352:Lipm UTSW 19 34112875 splice site probably benign
R0565:Lipm UTSW 19 34116506 missense probably benign 0.00
R1658:Lipm UTSW 19 34116447 missense probably benign
R2990:Lipm UTSW 19 34116486 missense probably benign 0.03
R4758:Lipm UTSW 19 34101170 start codon destroyed possibly damaging 0.59
R5446:Lipm UTSW 19 34117887 missense possibly damaging 0.92
R5468:Lipm UTSW 19 34109554 splice site probably null
R5905:Lipm UTSW 19 34111911 missense probably benign
R6066:Lipm UTSW 19 34112974 missense probably damaging 1.00
R6437:Lipm UTSW 19 34121257 missense probably damaging 1.00
R6722:Lipm UTSW 19 34121265 missense probably benign 0.00
R6927:Lipm UTSW 19 34101163 start gained probably benign
R7007:Lipm UTSW 19 34112097 missense probably damaging 1.00
R7031:Lipm UTSW 19 34116471 missense probably benign
R7081:Lipm UTSW 19 34121323 missense possibly damaging 0.90
R7092:Lipm UTSW 19 34121358 missense possibly damaging 0.75
R7419:Lipm UTSW 19 34116481 missense probably benign 0.09
R7426:Lipm UTSW 19 34116198 missense possibly damaging 0.56
R7772:Lipm UTSW 19 34117891 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTGCCAAAAGAACCAGATTCACGC -3'
(R):5'- TCCCATGCCCTGCTGAAATGAAG -3'

Sequencing Primer
(F):5'- GATCTCTAAAGGGACTCCCAGTG -3'
(R):5'- CCTGCTGAAATGAAGGGTCTG -3'
Posted On2013-10-16