Incidental Mutation 'R0816:Vmn1r215'
ID78609
Institutional Source Beutler Lab
Gene Symbol Vmn1r215
Ensembl Gene ENSMUSG00000099917
Gene Namevomeronasal 1 receptor 215
SynonymsV1ri2
MMRRC Submission 038996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0816 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23068025-23078006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23075954 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 55 (M55V)
Ref Sequence ENSEMBL: ENSMUSP00000154763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072972] [ENSMUST00000228092]
Predicted Effect probably benign
Transcript: ENSMUST00000072972
AA Change: M55V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072739
Gene: ENSMUSG00000099917
AA Change: M55V

DomainStartEndE-ValueType
Pfam:V1R 35 298 2.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228092
AA Change: M55V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.2%
  • 20x: 83.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 5 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ciz1 GGAAGAAGAAGAAGAAG GGAAGAAGAAGAAG 2: 32,376,376 probably benign Het
Dock11 G A X: 36,020,035 R1102H probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Other mutations in Vmn1r215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Vmn1r215 APN 13 23076249 missense probably damaging 0.98
IGL02515:Vmn1r215 APN 13 23075820 missense probably benign 0.21
IGL03061:Vmn1r215 APN 13 23075918 missense probably damaging 0.97
PIT4651001:Vmn1r215 UTSW 13 23076360 missense probably damaging 0.97
R0196:Vmn1r215 UTSW 13 23076084 missense probably damaging 1.00
R0817:Vmn1r215 UTSW 13 23075954 missense probably benign 0.00
R0820:Vmn1r215 UTSW 13 23075954 missense probably benign 0.00
R1104:Vmn1r215 UTSW 13 23076588 missense possibly damaging 0.50
R1733:Vmn1r215 UTSW 13 23076678 missense probably benign 0.43
R1912:Vmn1r215 UTSW 13 23076503 missense possibly damaging 0.94
R2010:Vmn1r215 UTSW 13 23076208 missense probably damaging 1.00
R2510:Vmn1r215 UTSW 13 23076173 missense probably benign 0.00
R2511:Vmn1r215 UTSW 13 23076173 missense probably benign 0.00
R2877:Vmn1r215 UTSW 13 23076561 missense probably benign 0.01
R3429:Vmn1r215 UTSW 13 23076208 missense probably damaging 1.00
R3854:Vmn1r215 UTSW 13 23075888 missense probably benign
R4124:Vmn1r215 UTSW 13 23075993 missense probably benign 0.42
R4235:Vmn1r215 UTSW 13 23075931 missense probably benign 0.31
R4979:Vmn1r215 UTSW 13 23075894 missense probably benign 0.04
R4991:Vmn1r215 UTSW 13 23076527 missense probably damaging 1.00
R5011:Vmn1r215 UTSW 13 23076551 missense probably damaging 1.00
R5026:Vmn1r215 UTSW 13 23076279 missense probably benign 0.30
R5070:Vmn1r215 UTSW 13 23076496 missense probably benign 0.03
R5589:Vmn1r215 UTSW 13 23076019 missense probably damaging 1.00
R5589:Vmn1r215 UTSW 13 23076020 missense probably damaging 1.00
R5651:Vmn1r215 UTSW 13 23075811 missense possibly damaging 0.93
R5928:Vmn1r215 UTSW 13 23076317 missense possibly damaging 0.50
R6176:Vmn1r215 UTSW 13 23076358 missense probably damaging 1.00
R6228:Vmn1r215 UTSW 13 23076463 missense probably benign 0.19
R7270:Vmn1r215 UTSW 13 23075919 missense possibly damaging 0.77
R7313:Vmn1r215 UTSW 13 23076314 missense probably benign 0.01
R7820:Vmn1r215 UTSW 13 23076545 missense probably damaging 1.00
R8515:Vmn1r215 UTSW 13 23075867 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACTGTGACCAGGCATCCTCAAAG -3'
(R):5'- AGACCTGTTCAAGCTACTGCCTCC -3'

Sequencing Primer
(F):5'- CCTAGTGTTGTGCTTAAAGTCAGAAG -3'
(R):5'- CCTCCTTTGATGTAGGAGAGCAAG -3'
Posted On2013-10-16