Incidental Mutation 'R0816:Trappc9'
ID 78611
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Name trafficking protein particle complex 9
Synonyms TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
MMRRC Submission 038996-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0816 (G1)
Quality Score 163
Status Not validated
Chromosome 15
Chromosomal Location 72461469-72933053 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 72897816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 377 (R377W)
Ref Sequence ENSEMBL: ENSMUSP00000131997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023276
AA Change: R189W

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: R189W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089770
AA Change: R368W

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: R368W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168191
AA Change: R368W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: R368W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170633
AA Change: R377W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: R377W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000228960
AA Change: R368W

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230270
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.2%
  • 20x: 83.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 5 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ciz1 GGAAGAAGAAGAAGAAG GGAAGAAGAAGAAG 2: 32,266,388 (GRCm39) probably benign Het
Dock11 G A X: 35,283,688 (GRCm39) R1102H probably damaging Het
Polr3a G A 14: 24,534,232 (GRCm39) P91L probably damaging Het
Sfi1 TCGC TC 11: 3,096,254 (GRCm39) probably null Het
Vmn1r215 A G 13: 23,260,124 (GRCm39) M55V probably benign Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 72,897,875 (GRCm39) missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72,808,858 (GRCm39) missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72,462,002 (GRCm39) missense probably benign 0.31
IGL01521:Trappc9 APN 15 72,924,016 (GRCm39) missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72,817,971 (GRCm39) missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72,871,841 (GRCm39) missense probably damaging 1.00
IGL02214:Trappc9 APN 15 72,884,731 (GRCm39) nonsense probably null
IGL02693:Trappc9 APN 15 72,835,542 (GRCm39) splice site probably benign
IGL03229:Trappc9 APN 15 72,930,305 (GRCm39) missense probably damaging 1.00
basilio UTSW 15 72,930,242 (GRCm39) missense probably damaging 1.00
Boomboom UTSW 15 72,608,718 (GRCm39) nonsense probably null
bronto UTSW 15 72,930,087 (GRCm39) nonsense probably null
Earl UTSW 15 72,608,626 (GRCm39) nonsense probably null
Sotto_aceto UTSW 15 72,557,188 (GRCm39) missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72,824,931 (GRCm39) missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 72,903,447 (GRCm39) frame shift probably null
PIT4519001:Trappc9 UTSW 15 72,824,943 (GRCm39) missense probably benign
R0001:Trappc9 UTSW 15 72,835,511 (GRCm39) missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72,894,929 (GRCm38) intron probably benign
R0745:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0747:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72,824,981 (GRCm39) splice site probably benign
R0819:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0820:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72,461,956 (GRCm39) missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72,871,823 (GRCm39) missense probably damaging 0.99
R1119:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1266:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1453:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1454:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72,565,397 (GRCm39) nonsense probably null
R1543:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1563:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1565:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72,808,958 (GRCm39) nonsense probably null
R1712:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1756:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1789:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1978:Trappc9 UTSW 15 72,871,874 (GRCm39) missense probably damaging 1.00
R2001:Trappc9 UTSW 15 72,929,885 (GRCm39) missense probably damaging 0.99
R2312:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R2334:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R2926:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3123:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3124:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3125:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3813:Trappc9 UTSW 15 72,930,242 (GRCm39) missense probably damaging 1.00
R4012:Trappc9 UTSW 15 72,903,472 (GRCm39) missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72,813,796 (GRCm39) missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72,462,641 (GRCm39) missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72,808,916 (GRCm39) missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72,808,909 (GRCm39) missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72,808,905 (GRCm39) missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72,808,905 (GRCm39) missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72,785,215 (GRCm39) intron probably benign
R5128:Trappc9 UTSW 15 72,930,242 (GRCm39) missense probably damaging 1.00
R5228:Trappc9 UTSW 15 72,929,844 (GRCm39) missense probably damaging 1.00
R5362:Trappc9 UTSW 15 72,930,066 (GRCm39) missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72,557,188 (GRCm39) missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72,797,379 (GRCm39) missense probably benign 0.43
R6032:Trappc9 UTSW 15 72,797,379 (GRCm39) missense probably benign 0.43
R6154:Trappc9 UTSW 15 72,929,930 (GRCm39) missense probably benign 0.03
R6372:Trappc9 UTSW 15 72,461,923 (GRCm39) missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72,461,993 (GRCm39) missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72,809,011 (GRCm39) splice site probably null
R6893:Trappc9 UTSW 15 72,797,499 (GRCm39) missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72,565,468 (GRCm39) missense probably benign 0.00
R7276:Trappc9 UTSW 15 72,924,119 (GRCm39) missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72,608,718 (GRCm39) nonsense probably null
R8260:Trappc9 UTSW 15 72,813,758 (GRCm39) nonsense probably null
R8399:Trappc9 UTSW 15 72,924,131 (GRCm39) missense probably damaging 1.00
R8683:Trappc9 UTSW 15 72,884,664 (GRCm39) missense probably benign 0.26
R8839:Trappc9 UTSW 15 72,930,087 (GRCm39) nonsense probably null
R8945:Trappc9 UTSW 15 72,929,945 (GRCm39) missense probably benign
R9083:Trappc9 UTSW 15 72,608,626 (GRCm39) nonsense probably null
R9323:Trappc9 UTSW 15 72,565,431 (GRCm39) missense probably benign 0.41
R9329:Trappc9 UTSW 15 72,673,202 (GRCm39) missense unknown
R9366:Trappc9 UTSW 15 72,808,937 (GRCm39) missense probably benign
R9723:Trappc9 UTSW 15 72,461,963 (GRCm39) missense possibly damaging 0.87
RF008:Trappc9 UTSW 15 72,673,138 (GRCm39) small insertion probably benign
RF009:Trappc9 UTSW 15 72,673,136 (GRCm39) small insertion probably benign
RF014:Trappc9 UTSW 15 72,673,132 (GRCm39) small insertion probably benign
RF016:Trappc9 UTSW 15 72,673,138 (GRCm39) small insertion probably benign
RF023:Trappc9 UTSW 15 72,673,180 (GRCm39) small insertion probably benign
RF023:Trappc9 UTSW 15 72,673,173 (GRCm39) small insertion probably benign
RF028:Trappc9 UTSW 15 72,673,139 (GRCm39) small insertion probably benign
RF029:Trappc9 UTSW 15 72,673,172 (GRCm39) small insertion probably benign
RF030:Trappc9 UTSW 15 72,673,174 (GRCm39) small insertion probably benign
RF034:Trappc9 UTSW 15 72,673,147 (GRCm39) small insertion probably benign
RF036:Trappc9 UTSW 15 72,673,169 (GRCm39) small insertion probably benign
RF038:Trappc9 UTSW 15 72,673,172 (GRCm39) small insertion probably benign
RF040:Trappc9 UTSW 15 72,673,141 (GRCm39) small insertion probably benign
RF042:Trappc9 UTSW 15 72,673,132 (GRCm39) small insertion probably benign
RF043:Trappc9 UTSW 15 72,673,154 (GRCm39) small insertion probably benign
RF049:Trappc9 UTSW 15 72,673,155 (GRCm39) small insertion probably benign
RF049:Trappc9 UTSW 15 72,673,150 (GRCm39) small insertion probably benign
RF053:Trappc9 UTSW 15 72,673,177 (GRCm39) small insertion probably benign
RF057:Trappc9 UTSW 15 72,673,144 (GRCm39) small insertion probably benign
RF063:Trappc9 UTSW 15 72,673,173 (GRCm39) small insertion probably benign
RF063:Trappc9 UTSW 15 72,673,169 (GRCm39) small insertion probably benign
Z1177:Trappc9 UTSW 15 72,924,011 (GRCm39) missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- AGGGCAAGCATCTCACAAGTGAC -3'
(R):5'- ATAGCTTTCCCCGAGGGTATCAGG -3'

Sequencing Primer
(F):5'- caaatcccagcaaccacac -3'
(R):5'- AGCCTTGGTGGCAGCTTC -3'
Posted On 2013-10-16