Incidental Mutation 'R0817:Ccdc106'
ID78613
Institutional Source Beutler Lab
Gene Symbol Ccdc106
Ensembl Gene ENSMUSG00000035228
Gene Namecoiled-coil domain containing 106
Synonyms
MMRRC Submission 038997-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0817 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5020553-5060785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5059540 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 11 (D11N)
Ref Sequence ENSEMBL: ENSMUSP00000146978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005041] [ENSMUST00000045543] [ENSMUST00000108571] [ENSMUST00000207097] [ENSMUST00000207215] [ENSMUST00000207974] [ENSMUST00000208728] [ENSMUST00000208042] [ENSMUST00000209099] [ENSMUST00000208161]
Predicted Effect probably benign
Transcript: ENSMUST00000005041
SMART Domains Protein: ENSMUSP00000005041
Gene: ENSMUSG00000030435

DomainStartEndE-ValueType
low complexity region 23 62 N/A INTRINSIC
PDB:1JMT|B 85 112 9e-13 PDB
RRM 150 227 1.26e-11 SMART
low complexity region 242 257 N/A INTRINSIC
RRM 260 333 8.64e-19 SMART
RRM 377 462 3.04e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000045543
AA Change: D120N

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041033
Gene: ENSMUSG00000035228
AA Change: D120N

DomainStartEndE-ValueType
coiled coil region 62 101 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108571
AA Change: D182N

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104211
Gene: ENSMUSG00000035228
AA Change: D182N

DomainStartEndE-ValueType
Pfam:CCDC106 117 337 1.4e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149912
AA Change: G416E
Predicted Effect probably benign
Transcript: ENSMUST00000207097
Predicted Effect probably benign
Transcript: ENSMUST00000207215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207960
Predicted Effect possibly damaging
Transcript: ENSMUST00000207974
AA Change: D120N

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208728
AA Change: D11N

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208606
Predicted Effect probably benign
Transcript: ENSMUST00000208042
Predicted Effect probably benign
Transcript: ENSMUST00000209099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208419
Predicted Effect probably benign
Transcript: ENSMUST00000208161
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 4 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Mycbp2 C T 14: 103,229,418 R1303Q probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn1r215 A G 13: 23,075,954 M55V probably benign Het
Other mutations in Ccdc106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02028:Ccdc106 APN 7 5059646 missense probably damaging 1.00
R0089:Ccdc106 UTSW 7 5056221 splice site probably null
R0103:Ccdc106 UTSW 7 5057545 missense probably benign
R0103:Ccdc106 UTSW 7 5057545 missense probably benign
R0440:Ccdc106 UTSW 7 5060245 missense probably damaging 1.00
R0705:Ccdc106 UTSW 7 5059540 missense possibly damaging 0.92
R0753:Ccdc106 UTSW 7 5059540 missense possibly damaging 0.92
R0767:Ccdc106 UTSW 7 5059540 missense possibly damaging 0.92
R0769:Ccdc106 UTSW 7 5059540 missense possibly damaging 0.92
R0775:Ccdc106 UTSW 7 5059540 missense possibly damaging 0.92
R0788:Ccdc106 UTSW 7 5057534 unclassified probably benign
R0818:Ccdc106 UTSW 7 5059540 missense possibly damaging 0.92
R0819:Ccdc106 UTSW 7 5059540 missense possibly damaging 0.92
R1161:Ccdc106 UTSW 7 5059540 missense possibly damaging 0.92
R1451:Ccdc106 UTSW 7 5059528 missense probably damaging 1.00
R1962:Ccdc106 UTSW 7 5059540 missense possibly damaging 0.92
R4771:Ccdc106 UTSW 7 5057522 splice site probably null
R5306:Ccdc106 UTSW 7 5058097 missense probably damaging 1.00
R5327:Ccdc106 UTSW 7 5060160 unclassified probably benign
R7256:Ccdc106 UTSW 7 5060326 missense probably damaging 0.99
R7467:Ccdc106 UTSW 7 5060326 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTGTTTCAGTCAAGTTCAGAGCC -3'
(R):5'- AGCCTTGGTCTTCCCAAATCGC -3'

Sequencing Primer
(F):5'- GCATTCAGTGTAGCTAATGTCTC -3'
(R):5'- AAATCGCTTCCGGCTAGTACTTC -3'
Posted On2013-10-16