Incidental Mutation 'R0817:Polr3a'
ID 78615
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC155, 9330175N20Rik, RPC1
MMRRC Submission 038997-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0817 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 24498764-24537126 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24534232 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 91 (P91L)
Ref Sequence ENSEMBL: ENSMUSP00000153243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect probably damaging
Transcript: ENSMUST00000026322
AA Change: P91L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: P91L

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223718
AA Change: P91L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225526
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 4 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc106 G A 7: 5,062,539 (GRCm39) D11N possibly damaging Het
Mycbp2 C T 14: 103,466,854 (GRCm39) R1303Q probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Vmn1r215 A G 13: 23,260,124 (GRCm39) M55V probably benign Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24,525,931 (GRCm39) missense probably benign 0.35
IGL00974:Polr3a APN 14 24,529,492 (GRCm39) missense probably benign 0.05
IGL01348:Polr3a APN 14 24,511,831 (GRCm39) missense probably damaging 1.00
IGL01464:Polr3a APN 14 24,520,749 (GRCm39) splice site probably benign
IGL01785:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01786:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01936:Polr3a APN 14 24,529,256 (GRCm39) missense probably damaging 1.00
IGL02095:Polr3a APN 14 24,504,678 (GRCm39) missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24,525,891 (GRCm39) missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24,520,945 (GRCm39) missense probably benign 0.07
IGL02961:Polr3a APN 14 24,517,108 (GRCm39) nonsense probably null
IGL03069:Polr3a APN 14 24,511,808 (GRCm39) missense probably damaging 0.99
R0001:Polr3a UTSW 14 24,502,257 (GRCm39) splice site probably benign
R0048:Polr3a UTSW 14 24,519,323 (GRCm39) splice site probably benign
R0157:Polr3a UTSW 14 24,529,254 (GRCm39) missense probably damaging 0.99
R0445:Polr3a UTSW 14 24,504,989 (GRCm39) missense probably benign 0.00
R0449:Polr3a UTSW 14 24,534,534 (GRCm39) missense probably damaging 0.99
R0597:Polr3a UTSW 14 24,534,202 (GRCm39) missense probably benign 0.29
R0604:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0644:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0703:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0754:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0767:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0816:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0819:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0840:Polr3a UTSW 14 24,502,268 (GRCm39) missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24,502,616 (GRCm39) missense probably null 0.98
R1644:Polr3a UTSW 14 24,520,692 (GRCm39) missense probably damaging 1.00
R1699:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R1704:Polr3a UTSW 14 24,534,188 (GRCm39) nonsense probably null
R2363:Polr3a UTSW 14 24,525,960 (GRCm39) splice site probably null
R3419:Polr3a UTSW 14 24,517,103 (GRCm39) missense probably damaging 1.00
R3934:Polr3a UTSW 14 24,526,169 (GRCm39) missense probably benign 0.30
R4296:Polr3a UTSW 14 24,503,264 (GRCm39) missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24,502,576 (GRCm39) splice site probably null
R4690:Polr3a UTSW 14 24,514,349 (GRCm39) missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24,502,692 (GRCm39) missense probably benign 0.11
R4947:Polr3a UTSW 14 24,532,532 (GRCm39) missense probably benign 0.00
R5232:Polr3a UTSW 14 24,503,279 (GRCm39) missense probably benign 0.00
R5263:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24,515,455 (GRCm39) splice site probably null
R5841:Polr3a UTSW 14 24,500,766 (GRCm39) missense probably benign 0.00
R6408:Polr3a UTSW 14 24,536,939 (GRCm39) critical splice donor site probably null
R6704:Polr3a UTSW 14 24,511,910 (GRCm39) missense probably damaging 1.00
R7136:Polr3a UTSW 14 24,511,883 (GRCm39) missense probably damaging 1.00
R7307:Polr3a UTSW 14 24,510,055 (GRCm39) missense probably benign 0.03
R7368:Polr3a UTSW 14 24,517,144 (GRCm39) missense probably damaging 0.98
R7800:Polr3a UTSW 14 24,534,455 (GRCm39) missense probably null 0.83
R8753:Polr3a UTSW 14 24,513,702 (GRCm39) nonsense probably null
R8785:Polr3a UTSW 14 24,502,383 (GRCm39) missense probably benign 0.06
R8848:Polr3a UTSW 14 24,500,834 (GRCm39) missense probably damaging 1.00
R9025:Polr3a UTSW 14 24,519,479 (GRCm39) missense probably damaging 1.00
R9139:Polr3a UTSW 14 24,519,416 (GRCm39) missense probably damaging 1.00
R9264:Polr3a UTSW 14 24,520,899 (GRCm39) missense probably benign
R9309:Polr3a UTSW 14 24,510,067 (GRCm39) missense probably benign
R9363:Polr3a UTSW 14 24,500,831 (GRCm39) missense probably damaging 1.00
R9526:Polr3a UTSW 14 24,503,313 (GRCm39) missense probably benign 0.00
R9585:Polr3a UTSW 14 24,502,289 (GRCm39) missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24,529,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCACGGCTTGCGATGAATAAACTAC -3'
(R):5'- TCCCAGTGTTCCACAGTTGACACG -3'

Sequencing Primer
(F):5'- agcaccaaacgccttacc -3'
(R):5'- ACGTGAAATCGTTGGTCCC -3'
Posted On 2013-10-16