Mutagenetix > Incidental Mutations

Incidental Mutation 'R0091:Lck'

78631

Institutional Source

Beutler Lab

Gene Symbol

Lck

Ensembl Gene

ENSMUSG00000000409

Gene Name

lymphocyte protein tyrosine kinase

Synonyms

Hck-3, p56

MMRRC Submission

038378-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0091 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

129548344-129573641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 129555681 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 274 (S274R)

Ref Sequence

ENSEMBL: ENSMUSP00000099656 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067240] [ENSMUST00000102596] [ENSMUST00000134336] [ENSMUST00000167288]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067240
AA Change: S274R

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000066209
Gene: ENSMUSG00000000409
AA Change: S274R

Domain	Start	End	E-Value	Type
SH3	64	120	3.53e-17	SMART
SH2	125	215	2.07e-34	SMART
TyrKc	245	494	2.66e-133	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102596
AA Change: S274R

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099656
Gene: ENSMUSG00000000409
AA Change: S274R

Domain	Start	End	E-Value	Type
SH3	64	120	3.53e-17	SMART
SH2	125	215	2.07e-34	SMART
TyrKc	245	494	2.66e-133	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123640

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127943

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132030

Predicted Effect

probably benign
Transcript: ENSMUST00000134336

SMART Domains

Protein: ENSMUSP00000119263
Gene: ENSMUSG00000000409

Domain	Start	End	E-Value	Type
PDB:1Q69\|B	7	33	9e-12	PDB
SCOP:d1awj__	45	92	2e-8	SMART
PDB:1LCK\|A	53	92	3e-20	PDB
Blast:SH3	64	92	4e-13	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139957

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167288
AA Change: S285R

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125777
Gene: ENSMUSG00000000409
AA Change: S285R

Domain	Start	End	E-Value	Type
SH3	75	131	3.53e-17	SMART
SH2	136	226	2.07e-34	SMART
TyrKc	256	505	2.66e-133	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183371

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 97.9%
10x: 94.4%
20x: 84.5%

Validation Efficiency

98% (86/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	C	3: 122,138,530	S278P	possibly damaging	Het
Adam11	A	G	11: 102,772,839	Y281C	probably damaging	Het
Adam6a	G	T	12: 113,544,229	R74L	possibly damaging	Het
Adcy5	T	C	16: 35,270,998		probably null	Het
Adrb2	A	G	18: 62,179,019	L245P	probably benign	Het
Aebp2	T	C	6: 140,644,074		probably null	Het
Arhgap23	A	G	11: 97,452,244	T240A	probably benign	Het
Atp10a	T	C	7: 58,774,046		probably benign	Het
Atp13a4	T	A	16: 29,455,395	Y416F	probably damaging	Het
Atp5g2	A	C	15: 102,663,057	L133R	probably damaging	Het
Bicral	A	T	17: 46,825,307	Y326N	probably damaging	Het
Chst4	T	C	8: 110,030,665	S189G	probably damaging	Het
Cnot1	A	T	8: 95,763,144	I477N	probably damaging	Het
Col7a1	G	T	9: 108,967,506		probably benign	Het
Dchs1	A	G	7: 105,766,094		probably benign	Het
Dcn	A	G	10: 97,506,689	N169S	probably benign	Het
Dnajc6	T	C	4: 101,616,777		probably benign	Het
Egln3	A	G	12: 54,181,646	F225L	probably benign	Het
Erap1	G	A	13: 74,668,052	R100Q	possibly damaging	Het
Erc2	A	T	14: 27,776,824		probably null	Het
Fto	G	A	8: 91,441,807		probably null	Het
Gdap1l1	C	T	2: 163,446,091	P80S	probably damaging	Het
Gm1123	T	C	9: 99,023,352	E35G	possibly damaging	Het
Hhipl1	A	G	12: 108,321,897		probably benign	Het
Ift80	A	T	3: 68,914,675	L679Q	probably damaging	Het
Il18	A	G	9: 50,576,713		probably benign	Het
Inhbb	T	C	1: 119,417,395	Y388C	probably damaging	Het
Kmt2d	G	T	15: 98,844,479		probably benign	Het
Krt20	A	G	11: 99,437,814	V95A	probably damaging	Het
Lrp1	T	A	10: 127,540,979	N4243I	probably damaging	Het
Lrrfip2	G	A	9: 111,214,243	V506I	probably damaging	Het
Ltbp2	A	G	12: 84,793,733	C1000R	probably damaging	Het
Matn3	G	A	12: 8,952,105	D106N	probably damaging	Het
Micalcl	A	G	7: 112,381,296	E49G	probably benign	Het
Mmadhc	A	G	2: 50,292,857	S36P	probably damaging	Het
Morn1	T	C	4: 155,145,172	Y433H	probably damaging	Het
Mpo	A	G	11: 87,801,610	M525V	probably benign	Het
Myo5a	C	T	9: 75,161,492	R659C	probably damaging	Het
Obox6	T	C	7: 15,834,439	S171G	probably benign	Het
Olfr1280	T	A	2: 111,316,173	D231E	probably benign	Het
Olfr347	A	G	2: 36,734,905	N195D	probably damaging	Het
Olfr998	A	T	2: 85,591,352	N271Y	probably benign	Het
P2ry14	A	G	3: 59,115,893	Y49H	probably benign	Het
Papss2	C	T	19: 32,633,902	T17I	possibly damaging	Het
Pcid2	T	C	8: 13,085,392	T206A	probably benign	Het
Pex6	A	G	17: 46,711,918	E140G	probably damaging	Het
Ppp1r3b	A	G	8: 35,384,667	Y220C	probably damaging	Het
Prdx2	T	G	8: 84,971,701		probably benign	Het
Ptbp2	A	T	3: 119,720,661	L471Q	probably damaging	Het
Rbm33	T	A	5: 28,352,606	D232E	possibly damaging	Het
Rnf214	T	A	9: 45,898,493		probably null	Het
Rora	G	A	9: 69,374,048	R314H	probably damaging	Het
Rufy4	T	C	1: 74,128,936		probably benign	Het
Sag	T	C	1: 87,814,680	V58A	probably damaging	Het
Serpina3i	C	T	12: 104,265,164	T20M	probably damaging	Het
Slc4a5	A	G	6: 83,277,555	N578S	probably benign	Het
Soat2	A	G	15: 102,158,139	Y285C	probably damaging	Het
Syk	A	G	13: 52,640,733	Y478C	probably damaging	Het
Syne4	G	A	7: 30,318,919	G362E	probably damaging	Het
Tas2r126	A	T	6: 42,435,102	M190L	probably benign	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Ttc19	A	G	11: 62,309,084	D218G	probably damaging	Het
Tut1	T	C	19: 8,965,436	V629A	probably damaging	Het
Txndc11	T	C	16: 11,088,104	N521D	probably benign	Het
Ushbp1	T	C	8: 71,388,970	E405G	possibly damaging	Het
Usp46	C	T	5: 74,003,257	R246Q	probably benign	Het
Utrn	T	C	10: 12,735,204	D469G	probably damaging	Het
Vmn2r104	T	A	17: 20,041,813	I352F	possibly damaging	Het
Wdr4	G	A	17: 31,496,916	T398I	probably benign	Het
Ythdc1	T	A	5: 86,820,701		probably benign	Het

Other mutations in Lck

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01824:Lck	APN	4	129558146	missense	probably benign	0.00
IGL02666:Lck	APN	4	129556419	missense	probably damaging	0.98
iconoclast	UTSW	4	129555604	missense	probably damaging	1.00
lockdown	UTSW	4	129558127	missense	probably damaging	1.00
stromberg	UTSW	4	129555640	missense	probably damaging	1.00
swan	UTSW	4	129555640	missense	probably damaging	1.00
R0480:Lck	UTSW	4	129555640	missense	probably damaging	1.00
R1013:Lck	UTSW	4	129558127	missense	probably damaging	1.00
R1510:Lck	UTSW	4	129555668	missense	possibly damaging	0.92
R1569:Lck	UTSW	4	129555656	missense	probably damaging	0.98
R1845:Lck	UTSW	4	129558086	missense	probably benign	0.00
R2001:Lck	UTSW	4	129548937	missense	probably benign	0.00
R2141:Lck	UTSW	4	129548920	missense	probably damaging	1.00
R4694:Lck	UTSW	4	129548972	missense	possibly damaging	0.66
R4737:Lck	UTSW	4	129555984	missense	possibly damaging	0.93
R5706:Lck	UTSW	4	129551638	critical splice acceptor site	probably null
R5712:Lck	UTSW	4	129556310	missense	probably benign
R7023:Lck	UTSW	4	129548865	missense	possibly damaging	0.89
R7411:Lck	UTSW	4	129551970	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TCTGAAACCCAGGTGGGCATTG -3'
(R):5'- TGACCCTCGGGACTGATTGGAAAG -3'

Sequencing Primer
(F):5'- ACGTTCTTCCAAAGCTTAGGG -3'
(R):5'- CGGGACTGATTGGAAAGAGGAG -3'

Posted On

2013-10-31