Incidental Mutation '0152:Usp47'
ID8
Institutional Source Beutler Lab
Gene Symbol Usp47
Ensembl Gene ENSMUSG00000059263
Gene Nameubiquitin specific peptidase 47
SynonymsA630020C16Rik, 4930502N04Rik
Accession Numbers

Genbank: NM_133758; MGI: 1922246

Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #0152 of strain feeble
Quality Score
Status Validated
Chromosome7
Chromosomal Location112023504-112111661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112056577 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 154 (Y154H)
Ref Sequence ENSEMBL: ENSMUSP00000102264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106653] [ENSMUST00000210309] [ENSMUST00000215510]
Predicted Effect probably damaging
Transcript: ENSMUST00000106653
AA Change: Y154H

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102264
Gene: ENSMUSG00000059263
AA Change: Y154H

DomainStartEndE-ValueType
Pfam:UCH 167 541 1.2e-50 PFAM
Pfam:UCH_1 168 507 5.1e-31 PFAM
coiled coil region 554 586 N/A INTRINSIC
low complexity region 859 880 N/A INTRINSIC
low complexity region 934 950 N/A INTRINSIC
Pfam:Ubiquitin_2 1026 1095 1.9e-3 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000210309
AA Change: Y174H

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211791
Predicted Effect possibly damaging
Transcript: ENSMUST00000215510
AA Change: Y154H

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.0926 question?
Coding Region Coverage
  • 1x: 77.9%
  • 3x: 41.0%
Validation Efficiency 83% (65/78)
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a gene trap allele exhibit increased sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 6 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A T 12: 88,431,151 Q185L probably benign Het
Fscn3 A G 6: 28,429,967 probably benign Homo
Per1 T G 11: 69,104,022 probably benign Het
Pkhd1 A C 1: 20,522,894 I1665S possibly damaging Het
Tnrc6a C A 7: 123,180,654 P1303T probably damaging Het
Zfp952 T A 17: 33,003,221 probably null Het
Other mutations in Usp47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp47 APN 7 112074783 missense probably benign 0.00
IGL00574:Usp47 APN 7 112063335 missense probably damaging 1.00
IGL00975:Usp47 APN 7 112093370 missense probably damaging 1.00
IGL01289:Usp47 APN 7 112063358 missense probably damaging 1.00
IGL01419:Usp47 APN 7 112087911 missense possibly damaging 0.94
IGL01645:Usp47 APN 7 112054862 missense probably damaging 0.96
IGL01871:Usp47 APN 7 112077786 splice site probably benign
IGL02066:Usp47 APN 7 112064397 missense probably damaging 1.00
IGL02122:Usp47 APN 7 112106908 missense probably damaging 0.97
IGL02153:Usp47 APN 7 112104049 missense probably benign 0.00
IGL02550:Usp47 APN 7 112104354 missense probably damaging 1.00
IGL02710:Usp47 APN 7 112092925 missense probably benign 0.01
IGL02756:Usp47 APN 7 112093063 missense possibly damaging 0.76
IGL03093:Usp47 APN 7 112089620 missense probably damaging 1.00
IGL03398:Usp47 APN 7 112074503 missense probably damaging 1.00
PIT4142001:Usp47 UTSW 7 112104341 splice site probably benign
R0110:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0381:Usp47 UTSW 7 112063393 critical splice donor site probably null
R0450:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0634:Usp47 UTSW 7 112108655 missense probably damaging 1.00
R0881:Usp47 UTSW 7 112091436 missense possibly damaging 0.51
R1178:Usp47 UTSW 7 112109998 missense possibly damaging 0.68
R1447:Usp47 UTSW 7 112074568 critical splice donor site probably null
R1640:Usp47 UTSW 7 112083127 missense probably damaging 0.99
R1727:Usp47 UTSW 7 112086100 missense probably damaging 0.96
R1866:Usp47 UTSW 7 112101870 missense possibly damaging 0.93
R1876:Usp47 UTSW 7 112054920 missense probably damaging 0.99
R1953:Usp47 UTSW 7 112092876 missense probably benign 0.26
R2117:Usp47 UTSW 7 112067236 critical splice donor site probably null
R2176:Usp47 UTSW 7 112092727 missense probably benign 0.00
R2187:Usp47 UTSW 7 112067191 missense probably damaging 1.00
R2504:Usp47 UTSW 7 112104470 critical splice donor site probably null
R2902:Usp47 UTSW 7 112093451 missense probably damaging 1.00
R2922:Usp47 UTSW 7 112093198 missense probably damaging 1.00
R2939:Usp47 UTSW 7 112082536 missense probably damaging 1.00
R4065:Usp47 UTSW 7 112053416 missense probably benign 0.30
R4179:Usp47 UTSW 7 112087884 missense probably damaging 1.00
R4235:Usp47 UTSW 7 112110048 missense probably damaging 0.99
R4243:Usp47 UTSW 7 112108629 missense probably damaging 1.00
R4281:Usp47 UTSW 7 112109993 missense probably benign 0.03
R4360:Usp47 UTSW 7 112054932 missense probably damaging 1.00
R4604:Usp47 UTSW 7 112101831 missense probably damaging 1.00
R4857:Usp47 UTSW 7 112082552 missense probably damaging 1.00
R5133:Usp47 UTSW 7 112083882 missense probably damaging 1.00
R5179:Usp47 UTSW 7 112093432 missense probably damaging 1.00
R5322:Usp47 UTSW 7 112053269 missense probably damaging 0.99
R5445:Usp47 UTSW 7 112074721 missense probably damaging 1.00
R5465:Usp47 UTSW 7 112059002 missense probably damaging 1.00
R5699:Usp47 UTSW 7 112109997 missense probably benign 0.00
R5961:Usp47 UTSW 7 112053316 missense probably damaging 1.00
R6117:Usp47 UTSW 7 112087932 missense probably damaging 0.98
R6271:Usp47 UTSW 7 112087056 missense probably damaging 1.00
R7155:Usp47 UTSW 7 112087013 missense probably damaging 0.97
R7229:Usp47 UTSW 7 112092877 missense probably benign 0.04
R7246:Usp47 UTSW 7 112115909
R7285:Usp47 UTSW 7 112093108 missense probably benign 0.02
R7938:Usp47 UTSW 7 112087925 missense probably damaging 0.99
R8079:Usp47 UTSW 7 112046970 missense probably damaging 1.00
R8114:Usp47 UTSW 7 112093187 missense probably damaging 1.00
R8141:Usp47 UTSW 7 112053265 missense possibly damaging 0.60
R8172:Usp47 UTSW 7 112087926 nonsense probably null
R8223:Usp47 UTSW 7 112104376 missense probably damaging 1.00
R8510:Usp47 UTSW 7 112059001 missense probably damaging 1.00
RF010:Usp47 UTSW 7 112092938 missense probably damaging 0.99
X0027:Usp47 UTSW 7 112087847 missense probably damaging 1.00
Nature of Mutation
DNA sequencing using the SOLiD technique identified a T to C transition at position 662 of the Usp47 transcript, in exon 4 of 28 total exons for isoform 2 (Figure 1). In isoform 1, the mutation occurs in exon 5 of 29 total exons. Multiple isoforms of Usp47 are displayed on Ensembl
 
647 TATGTCAGCCAGAACTACTCCTATTCATCAATT
149 -Y--V--S--Q--N--Y--S--Y--S--S--I-
 
The mutated nucleotide is indicated in red lettering, and causes a tyrosine to histidine substitution at amino acid 174 in isoform 1 and amino acid 154 in isoform 2 of the encoded protein. The mutation has been confirmed by DNA sequencing using the Sanger method (Figure 2).
Protein Function and Prediction
The 1376 (isoform 1) amino acid mouse USP47 protein is an uncharacterized ubiquitinyl hydrolase belonging to the peptidase C19 family of proteases. These proteins are also known as ubiquitin-specific processing proteases (UPB). Ubiquitin is a small highly conserved protein that is commonly found conjugated to proteins in eukaryotic cells, where it may act as a marker for rapid degradation, or it may have a chaperone function in protein assembly (1). Ubiquitin is released by cleavage from the bound protein by a protease. Members of the C19 peptidase family are considered to be cysteine peptidases and use the sulphydryl group of a cysteine residue as the nucleophile to form an acyl intermediate. These proteins are characterized by one conserved cysteine (amino acid 197 in USP47), along with two conserved histidines (amino acids 495 and 503). The spacing between the cysteine and the second histidine is thought to be more representative of the cysteine/histidine spacing of a cysteine protease catalytic dyad. UPB proteins are divergent, but exhibit strong homology in the regions surrounding the catalytic Cys and His residues; these are the Cys Box (roughly 19 amino acids) and the His Box (60–90 amino acids). 3D structure of a UPB catalytic domain is depicted in Figure 3 (NCBI cd02659). Ubiquitin binds to a cleft in this domain, which is bordered on opposite sides by the Cys and His Boxes (2)
 
USP47 is phosphorylated on serine 911 (3) and threonine 1016 (4). Other sites predicted to be phosphorylated by homology are serines 832 and 1354, and tyrosine 836.  
 

Isoform 2 of USP47, created by alternative splicing, is missing amino acids 14-33. The Y154/174H alteration occurs just prior to the conserved peptidase C19 domain containing the catalytic cysteine and histidines, and is predicted to be possibly damaging by the PolyPhen program. 

References
Posted On2009-11-02