Incidental Mutation 'R0880:Ifi209'
ID80449
Institutional Source Beutler Lab
Gene Symbol Ifi209
Ensembl Gene ENSMUSG00000043263
Gene Nameinterferon activated gene 209
SynonymsIfix, Pyhin1, Pyhin-1
MMRRC Submission 039047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R0880 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173630917-173647928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 173644813 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 407 (S407T)
Ref Sequence ENSEMBL: ENSMUSP00000061900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056071] [ENSMUST00000193727]
Predicted Effect probably damaging
Transcript: ENSMUST00000056071
AA Change: S407T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000061900
Gene: ENSMUSG00000043263
AA Change: S407T

DomainStartEndE-ValueType
PYRIN 6 83 3.54e-17 SMART
low complexity region 152 169 N/A INTRINSIC
Pfam:HIN 231 396 4.2e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193727
SMART Domains Protein: ENSMUSP00000142161
Gene: ENSMUSG00000043263

DomainStartEndE-ValueType
PYRIN 6 83 1.7e-21 SMART
low complexity region 152 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200598
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,560,646 Y701H possibly damaging Het
A430078G23Rik A G 8: 3,389,032 probably benign Het
Akap6 A G 12: 53,139,508 D1235G possibly damaging Het
Astn2 A G 4: 65,648,330 Y812H probably damaging Het
B230118H07Rik T A 2: 101,576,110 T158S probably benign Het
Bmpr1b G T 3: 141,870,796 S92* probably null Het
Camsap2 T C 1: 136,280,970 D934G probably benign Het
Cdh23 A G 10: 60,406,421 V1076A possibly damaging Het
Cdhr1 T C 14: 37,080,634 D624G possibly damaging Het
Cfap57 A T 4: 118,581,838 Y830* probably null Het
Dgcr14 A G 16: 17,911,187 V40A probably damaging Het
Eml3 A G 19: 8,940,915 D790G possibly damaging Het
Gucy2c T C 6: 136,709,832 probably null Het
Helz2 A C 2: 181,236,135 S957A probably benign Het
Muc6 T C 7: 141,637,357 T2403A possibly damaging Het
Nfe2 T C 15: 103,249,262 N101D probably damaging Het
Nsf A T 11: 103,913,372 V178D possibly damaging Het
P4ha3 A G 7: 100,305,909 T324A probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Rhbdf1 T C 11: 32,213,432 probably null Het
Samd9l G A 6: 3,377,064 L66F probably damaging Het
Speg T C 1: 75,405,061 F1024S probably damaging Het
Sspo A G 6: 48,475,935 N2859S possibly damaging Het
Tnfrsf21 G A 17: 43,037,842 W115* probably null Het
Other mutations in Ifi209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ifi209 APN 1 173638963 missense possibly damaging 0.88
IGL02598:Ifi209 APN 1 173644715 missense probably damaging 0.99
IGL02712:Ifi209 APN 1 173642701 missense possibly damaging 0.68
IGL03131:Ifi209 APN 1 173641234 missense possibly damaging 0.86
IGL03368:Ifi209 APN 1 173642491 missense possibly damaging 0.91
R1317:Ifi209 UTSW 1 173637463 missense possibly damaging 0.96
R1640:Ifi209 UTSW 1 173637365 missense probably damaging 0.98
R1769:Ifi209 UTSW 1 173641162 missense probably benign 0.11
R2349:Ifi209 UTSW 1 173642556 missense probably damaging 1.00
R5096:Ifi209 UTSW 1 173644734 missense probably benign 0.17
R5369:Ifi209 UTSW 1 173637307 start codon destroyed probably null 1.00
R5484:Ifi209 UTSW 1 173641074 missense probably benign 0.18
R5532:Ifi209 UTSW 1 173638976 missense probably damaging 0.99
R5551:Ifi209 UTSW 1 173641197 missense probably benign 0.01
R5554:Ifi209 UTSW 1 173641197 missense probably benign 0.01
R5749:Ifi209 UTSW 1 173637327 missense probably damaging 1.00
R5960:Ifi209 UTSW 1 173638816 splice site probably null
R6401:Ifi209 UTSW 1 173644703 missense probably damaging 0.99
R7042:Ifi209 UTSW 1 173642670 missense probably benign 0.34
R7304:Ifi209 UTSW 1 173642590 missense possibly damaging 0.88
R7521:Ifi209 UTSW 1 173642695 missense probably damaging 0.97
R7742:Ifi209 UTSW 1 173642632 missense probably damaging 1.00
R7763:Ifi209 UTSW 1 173642879 missense probably damaging 1.00
R7975:Ifi209 UTSW 1 173641156 missense probably benign 0.24
Z1088:Ifi209 UTSW 1 173637407 missense probably damaging 0.99
Z1088:Ifi209 UTSW 1 173641146 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTACCTCGTATCTCAACCTATAGCTC -3'
(R):5'- GATCTGTGTGTCAGGGTGACAAGAAAA -3'

Sequencing Primer
(F):5'- GCCATTTCTCATGGAATGAGC -3'
(R):5'- gcctccaactcatacatatcaac -3'
Posted On2013-11-07