Incidental Mutation 'R0880:B230118H07Rik'
ID80450
Institutional Source Beutler Lab
Gene Symbol B230118H07Rik
Ensembl Gene ENSMUSG00000027165
Gene NameRIKEN cDNA B230118H07 gene
SynonymsNWC
MMRRC Submission 039047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0880 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location101560781-101649532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101576110 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 158 (T158S)
Ref Sequence ENSEMBL: ENSMUSP00000097274 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000090513
AA Change: T158S

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000099682
AA Change: T158S

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000111231
AA Change: T158S

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000128898
AA Change: T158S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000136601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138903
Predicted Effect probably benign
Transcript: ENSMUST00000160037
AA Change: T158S

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000160722
AA Change: T158S

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000177152
AA Change: T6S

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified as a cellular interacting partner of non-structural protein 10 of the severe acute respiratory syndrome coronavirus (SARS-CoV). The encoded protein may function as a negative regulator of transcription. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous deletion of one of two alternative first exons and its promoter has no obvious phenotypic effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,560,646 Y701H possibly damaging Het
A430078G23Rik A G 8: 3,389,032 probably benign Het
Akap6 A G 12: 53,139,508 D1235G possibly damaging Het
Astn2 A G 4: 65,648,330 Y812H probably damaging Het
Bmpr1b G T 3: 141,870,796 S92* probably null Het
Camsap2 T C 1: 136,280,970 D934G probably benign Het
Cdh23 A G 10: 60,406,421 V1076A possibly damaging Het
Cdhr1 T C 14: 37,080,634 D624G possibly damaging Het
Cfap57 A T 4: 118,581,838 Y830* probably null Het
Dgcr14 A G 16: 17,911,187 V40A probably damaging Het
Eml3 A G 19: 8,940,915 D790G possibly damaging Het
Gucy2c T C 6: 136,709,832 probably null Het
Helz2 A C 2: 181,236,135 S957A probably benign Het
Ifi209 T A 1: 173,644,813 S407T probably damaging Het
Muc6 T C 7: 141,637,357 T2403A possibly damaging Het
Nfe2 T C 15: 103,249,262 N101D probably damaging Het
Nsf A T 11: 103,913,372 V178D possibly damaging Het
P4ha3 A G 7: 100,305,909 T324A probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Rhbdf1 T C 11: 32,213,432 probably null Het
Samd9l G A 6: 3,377,064 L66F probably damaging Het
Speg T C 1: 75,405,061 F1024S probably damaging Het
Sspo A G 6: 48,475,935 N2859S possibly damaging Het
Tnfrsf21 G A 17: 43,037,842 W115* probably null Het
Other mutations in B230118H07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03347:B230118H07Rik APN 2 101583519 critical splice donor site probably null
IGL03384:B230118H07Rik APN 2 101585263 missense probably benign 0.00
R0190:B230118H07Rik UTSW 2 101586430 missense probably benign 0.16
R0436:B230118H07Rik UTSW 2 101610519 splice site probably benign
R0591:B230118H07Rik UTSW 2 101576117 missense probably benign 0.14
R1608:B230118H07Rik UTSW 2 101610571 missense probably damaging 1.00
R6008:B230118H07Rik UTSW 2 101583553 missense possibly damaging 0.52
R6060:B230118H07Rik UTSW 2 101610605 missense probably benign 0.06
R6155:B230118H07Rik UTSW 2 101576010 critical splice donor site probably null
R6805:B230118H07Rik UTSW 2 101566459 missense probably benign 0.29
R7209:B230118H07Rik UTSW 2 101566382 makesense probably null
R7258:B230118H07Rik UTSW 2 101610592 missense probably null 0.96
R7680:B230118H07Rik UTSW 2 101610556 missense probably damaging 1.00
R7898:B230118H07Rik UTSW 2 101586402 missense probably benign 0.34
R7981:B230118H07Rik UTSW 2 101586402 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GTGCTTCTACAGCCAAACACCATTG -3'
(R):5'- AGTCAGGTTCACAGACGAAGACCC -3'

Sequencing Primer
(F):5'- GACTCTAAATTATCCCAAACCAAGG -3'
(R):5'- TACTTGGGGGAGATGACGAA -3'
Posted On2013-11-07