Incidental Mutation 'R0880:Pdia3'
ID80451
Institutional Source Beutler Lab
Gene Symbol Pdia3
Ensembl Gene ENSMUSG00000027248
Gene Nameprotein disulfide isomerase associated 3
SynonymsERp61, Plca, PDI, Grp58, Erp, PDI-Q2, ERp57, ERp60
MMRRC Submission 039047-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0880 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121413775-121438687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121432377 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 275 (G275S)
Ref Sequence ENSEMBL: ENSMUSP00000028683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028683] [ENSMUST00000135079]
Predicted Effect probably damaging
Transcript: ENSMUST00000028683
AA Change: G275S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028683
Gene: ENSMUSG00000027248
AA Change: G275S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Thioredoxin 26 131 5.2e-36 PFAM
Pfam:Thioredoxin_6 160 355 2e-29 PFAM
Pfam:Thioredoxin 377 483 9.5e-33 PFAM
low complexity region 487 503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130450
Predicted Effect probably benign
Transcript: ENSMUST00000135079
SMART Domains Protein: ENSMUSP00000119337
Gene: ENSMUSG00000027248

DomainStartEndE-ValueType
Pfam:Thioredoxin 3 105 5.1e-35 PFAM
Meta Mutation Damage Score 0.4603 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of the endoplasmic reticulum that interacts with lectin chaperones calreticulin and calnexin to modulate folding of newly synthesized glycoproteins. The protein was once thought to be a phospholipase; however, it has been demonstrated that the protein actually has protein disulfide isomerase activity. It is thought that complexes of lectins and this protein mediate protein folding by promoting formation of disulfide bonds in their glycoprotein substrates. This protein also functions as a molecular chaperone that prevents the formation of protein aggregates. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele die by E13.5 with minor changes in ER calcium capacity and unfolded protein response in mouse embryonic fibroblasts. Mice homozygous for a gene trap allele die prior to birth while heterozygous mice exhibit abnormalbone volume bone morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,560,646 Y701H possibly damaging Het
A430078G23Rik A G 8: 3,389,032 probably benign Het
Akap6 A G 12: 53,139,508 D1235G possibly damaging Het
Astn2 A G 4: 65,648,330 Y812H probably damaging Het
B230118H07Rik T A 2: 101,576,110 T158S probably benign Het
Bmpr1b G T 3: 141,870,796 S92* probably null Het
Camsap2 T C 1: 136,280,970 D934G probably benign Het
Cdh23 A G 10: 60,406,421 V1076A possibly damaging Het
Cdhr1 T C 14: 37,080,634 D624G possibly damaging Het
Cfap57 A T 4: 118,581,838 Y830* probably null Het
Dgcr14 A G 16: 17,911,187 V40A probably damaging Het
Eml3 A G 19: 8,940,915 D790G possibly damaging Het
Gucy2c T C 6: 136,709,832 probably null Het
Helz2 A C 2: 181,236,135 S957A probably benign Het
Ifi209 T A 1: 173,644,813 S407T probably damaging Het
Muc6 T C 7: 141,637,357 T2403A possibly damaging Het
Nfe2 T C 15: 103,249,262 N101D probably damaging Het
Nsf A T 11: 103,913,372 V178D possibly damaging Het
P4ha3 A G 7: 100,305,909 T324A probably benign Het
Rhbdf1 T C 11: 32,213,432 probably null Het
Samd9l G A 6: 3,377,064 L66F probably damaging Het
Speg T C 1: 75,405,061 F1024S probably damaging Het
Sspo A G 6: 48,475,935 N2859S possibly damaging Het
Tnfrsf21 G A 17: 43,037,842 W115* probably null Het
Other mutations in Pdia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Pdia3 APN 2 121414178 missense probably damaging 1.00
IGL00777:Pdia3 APN 2 121429556 missense probably damaging 1.00
IGL02020:Pdia3 APN 2 121436419 splice site probably null
IGL02437:Pdia3 APN 2 121433648 missense probably damaging 1.00
IGL02988:Pdia3 UTSW 2 121429556 missense probably damaging 1.00
PIT4812001:Pdia3 UTSW 2 121433530 missense probably damaging 1.00
R0242:Pdia3 UTSW 2 121414111 missense probably damaging 1.00
R0242:Pdia3 UTSW 2 121414111 missense probably damaging 1.00
R0606:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0612:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0658:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0724:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0730:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0882:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1157:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1160:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1238:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1619:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1853:Pdia3 UTSW 2 121431663 missense probably benign 0.20
R1854:Pdia3 UTSW 2 121431663 missense probably benign 0.20
R2014:Pdia3 UTSW 2 121434820 missense probably damaging 1.00
R2103:Pdia3 UTSW 2 121433993 missense probably damaging 1.00
R4160:Pdia3 UTSW 2 121414115 missense probably damaging 1.00
R4628:Pdia3 UTSW 2 121414139 missense possibly damaging 0.91
R5032:Pdia3 UTSW 2 121414139 missense probably benign 0.28
R5279:Pdia3 UTSW 2 121414003 unclassified probably benign
R5598:Pdia3 UTSW 2 121414130 missense possibly damaging 0.53
R5815:Pdia3 UTSW 2 121436411 nonsense probably null
R7162:Pdia3 UTSW 2 121429521 missense probably benign 0.00
R7729:Pdia3 UTSW 2 121432357 missense possibly damaging 0.77
X0012:Pdia3 UTSW 2 121435945 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTGTGGACCCATTACCTCTTACAGTG -3'
(R):5'- GCAGTTTCTGGAGCTATGTGTTCCC -3'

Sequencing Primer
(F):5'- GCATTGTGTTGATAATGACTTCCTC -3'
(R):5'- gtccagattagccacaaattcag -3'
Posted On2013-11-07