Incidental Mutation 'R0880:P4ha3'
ID80465
Institutional Source Beutler Lab
Gene Symbol P4ha3
Ensembl Gene ENSMUSG00000051048
Gene Nameprocollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III
Synonyms
MMRRC Submission 039047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0880 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location100285520-100319699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100305909 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 324 (T324A)
Ref Sequence ENSEMBL: ENSMUSP00000055297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057023] [ENSMUST00000139790]
Predicted Effect probably benign
Transcript: ENSMUST00000057023
AA Change: T324A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000055297
Gene: ENSMUSG00000051048
AA Change: T324A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:P4Ha_N 31 159 1.4e-31 PFAM
SCOP:d1ihga1 177 258 8e-4 SMART
P4Hc 344 526 1.08e-50 SMART
Predicted Effect unknown
Transcript: ENSMUST00000138465
AA Change: T190A
SMART Domains Protein: ENSMUSP00000119159
Gene: ENSMUSG00000051048
AA Change: T190A

DomainStartEndE-ValueType
PDB:4BTB|A 1 141 7e-17 PDB
SCOP:d1ihga1 44 125 4e-4 SMART
P4Hc 211 372 4.89e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139790
SMART Domains Protein: ENSMUSP00000117015
Gene: ENSMUSG00000051048

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208565
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,560,646 Y701H possibly damaging Het
A430078G23Rik A G 8: 3,389,032 probably benign Het
Akap6 A G 12: 53,139,508 D1235G possibly damaging Het
Astn2 A G 4: 65,648,330 Y812H probably damaging Het
B230118H07Rik T A 2: 101,576,110 T158S probably benign Het
Bmpr1b G T 3: 141,870,796 S92* probably null Het
Camsap2 T C 1: 136,280,970 D934G probably benign Het
Cdh23 A G 10: 60,406,421 V1076A possibly damaging Het
Cdhr1 T C 14: 37,080,634 D624G possibly damaging Het
Cfap57 A T 4: 118,581,838 Y830* probably null Het
Dgcr14 A G 16: 17,911,187 V40A probably damaging Het
Eml3 A G 19: 8,940,915 D790G possibly damaging Het
Gucy2c T C 6: 136,709,832 probably null Het
Helz2 A C 2: 181,236,135 S957A probably benign Het
Ifi209 T A 1: 173,644,813 S407T probably damaging Het
Muc6 T C 7: 141,637,357 T2403A possibly damaging Het
Nfe2 T C 15: 103,249,262 N101D probably damaging Het
Nsf A T 11: 103,913,372 V178D possibly damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Rhbdf1 T C 11: 32,213,432 probably null Het
Samd9l G A 6: 3,377,064 L66F probably damaging Het
Speg T C 1: 75,405,061 F1024S probably damaging Het
Sspo A G 6: 48,475,935 N2859S possibly damaging Het
Tnfrsf21 G A 17: 43,037,842 W115* probably null Het
Other mutations in P4ha3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:P4ha3 APN 7 100305933 missense probably damaging 1.00
IGL01875:P4ha3 APN 7 100300652 missense probably damaging 0.97
IGL02265:P4ha3 APN 7 100293932 missense probably benign
IGL02957:P4ha3 APN 7 100318905 splice site probably benign
IGL03279:P4ha3 APN 7 100300686 missense probably damaging 1.00
R0006:P4ha3 UTSW 7 100318948 nonsense probably null
R1066:P4ha3 UTSW 7 100318063 missense possibly damaging 0.77
R1118:P4ha3 UTSW 7 100313328 missense probably damaging 0.99
R1119:P4ha3 UTSW 7 100313328 missense probably damaging 0.99
R1236:P4ha3 UTSW 7 100293849 missense probably damaging 1.00
R1613:P4ha3 UTSW 7 100313250 missense possibly damaging 0.95
R1778:P4ha3 UTSW 7 100300691 splice site probably null
R2042:P4ha3 UTSW 7 100300690 critical splice donor site probably null
R3437:P4ha3 UTSW 7 100285624 missense possibly damaging 0.93
R4393:P4ha3 UTSW 7 100305607 missense probably benign 0.06
R5411:P4ha3 UTSW 7 100293815 missense probably damaging 1.00
R5722:P4ha3 UTSW 7 100305991 missense probably benign 0.03
R6209:P4ha3 UTSW 7 100317085 missense probably benign 0.09
R6462:P4ha3 UTSW 7 100314666 missense probably damaging 1.00
R6606:P4ha3 UTSW 7 100305644 missense probably damaging 0.99
R7578:P4ha3 UTSW 7 100293914 missense probably benign 0.02
R7769:P4ha3 UTSW 7 100285717 missense probably damaging 0.97
R8031:P4ha3 UTSW 7 100292698 missense probably damaging 1.00
R8090:P4ha3 UTSW 7 100300652 missense probably damaging 0.97
R8296:P4ha3 UTSW 7 100317102 missense probably damaging 1.00
R8379:P4ha3 UTSW 7 100293779 missense probably damaging 0.99
RF033:P4ha3 UTSW 7 100310810 frame shift probably null
Z1177:P4ha3 UTSW 7 100293788 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ACTGCAATTCAGAGGCCCAACG -3'
(R):5'- CAGAGGGTATTTGGGGATGCTCAC -3'

Sequencing Primer
(F):5'- CCTGATGCCTTAATGGTGATACAAC -3'
(R):5'- TCACCCACGGTTCTGCAAG -3'
Posted On2013-11-07