Incidental Mutation 'R0927:Arfgap2'
ID80466
Institutional Source Beutler Lab
Gene Symbol Arfgap2
Ensembl Gene ENSMUSG00000027255
Gene NameADP-ribosylation factor GTPase activating protein 2
Synonyms2310032E02Rik, Zfp289
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.800) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91264974-91276931 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91273805 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 374 (S374P)
Ref Sequence ENSEMBL: ENSMUSP00000078920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028691] [ENSMUST00000064652] [ENSMUST00000080008] [ENSMUST00000094835] [ENSMUST00000102594]
Predicted Effect probably benign
Transcript: ENSMUST00000028691
AA Change: S388P

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028691
Gene: ENSMUSG00000027255
AA Change: S388P

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 227 246 N/A INTRINSIC
coiled coil region 254 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Blast:ArfGap 370 434 6e-32 BLAST
low complexity region 468 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064652
Predicted Effect probably benign
Transcript: ENSMUST00000080008
AA Change: S374P

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078920
Gene: ENSMUSG00000027255
AA Change: S374P

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 213 232 N/A INTRINSIC
coiled coil region 240 307 N/A INTRINSIC
low complexity region 309 321 N/A INTRINSIC
internal_repeat_1 333 376 9.77e-5 PROSPERO
low complexity region 454 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094835
SMART Domains Protein: ENSMUSP00000092431
Gene: ENSMUSG00000040591

DomainStartEndE-ValueType
low complexity region 219 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102594
SMART Domains Protein: ENSMUSP00000099654
Gene: ENSMUSG00000040591

DomainStartEndE-ValueType
low complexity region 316 331 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146228
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a zinc-finger-containing GTPase-activating protein for ADP ribosylation factor 1 (ARF1), a small GTPase that plays a role in coatomer-mediated vesicular trafficking. This gene product stimulates the hydrolysis of ARF1-bound GTP, which may lead to dissociation of coatomer from Golgi-derived membranes to allow fusion with target membranes. It may regulate the retrograde transport from the Golgi complex to the endoplasmic reticulum. Expression of this gene has been shown to be controlled by inhibitor of DNA binding 1 (Id1). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 6. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Arfgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0097:Arfgap2 UTSW 2 91274815 missense probably benign 0.16
R0097:Arfgap2 UTSW 2 91274815 missense probably benign 0.16
R0178:Arfgap2 UTSW 2 91267361 missense probably benign 0.00
R1491:Arfgap2 UTSW 2 91274859 missense probably damaging 1.00
R1693:Arfgap2 UTSW 2 91270075 splice site probably null
R2091:Arfgap2 UTSW 2 91270241 missense probably benign 0.02
R2199:Arfgap2 UTSW 2 91265692 critical splice donor site probably null
R3772:Arfgap2 UTSW 2 91265366 missense probably benign
R3922:Arfgap2 UTSW 2 91274805 missense probably damaging 1.00
R3926:Arfgap2 UTSW 2 91274805 missense probably damaging 1.00
R4707:Arfgap2 UTSW 2 91269971 missense probably damaging 1.00
R4751:Arfgap2 UTSW 2 91267368 missense probably benign 0.10
R4923:Arfgap2 UTSW 2 91273659 missense probably damaging 1.00
R5249:Arfgap2 UTSW 2 91265637 nonsense probably null
R5541:Arfgap2 UTSW 2 91275769 missense probably benign 0.09
R5608:Arfgap2 UTSW 2 91270202 missense probably damaging 1.00
R5626:Arfgap2 UTSW 2 91275392 nonsense probably null
R6261:Arfgap2 UTSW 2 91270282 missense probably benign 0.00
R6300:Arfgap2 UTSW 2 91267195 missense probably benign 0.00
R6948:Arfgap2 UTSW 2 91267179 missense probably benign 0.00
R7531:Arfgap2 UTSW 2 91273744 splice site probably null
R8058:Arfgap2 UTSW 2 91266299 critical splice donor site probably null
Z1177:Arfgap2 UTSW 2 91275104 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGGAACATTTGCATCTGGACCCC -3'
(R):5'- ACTGAAACGGAAAATCAGGCTCCTC -3'

Sequencing Primer
(F):5'- CCCAAAGTAAGGCTGTTGC -3'
(R):5'- cagttcctcagcagcacc -3'
Posted On2013-11-07