Incidental Mutation 'R0880:A430078G23Rik'
ID80468
Institutional Source Beutler Lab
Gene Symbol A430078G23Rik
Ensembl Gene ENSMUSG00000074497
Gene NameRIKEN cDNA A430078G23 gene
Synonyms
MMRRC Submission 039047-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0880 (G1)
Quality Score217
Status Not validated
Chromosome8
Chromosomal Location3353415-3390299 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 3389032 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004684] [ENSMUST00000098966] [ENSMUST00000145394] [ENSMUST00000208363]
Predicted Effect probably benign
Transcript: ENSMUST00000004684
SMART Domains Protein: ENSMUSP00000004684
Gene: ENSMUSG00000004568

DomainStartEndE-ValueType
RhoGEF 105 297 2.62e-58 SMART
PH 340 443 5.57e-12 SMART
low complexity region 446 456 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
coiled coil region 697 800 N/A INTRINSIC
low complexity region 887 897 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 963 985 N/A INTRINSIC
low complexity region 991 1010 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000098966
AA Change: H463R
SMART Domains Protein: ENSMUSP00000096566
Gene: ENSMUSG00000074497
AA Change: H463R

DomainStartEndE-ValueType
low complexity region 116 134 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131773
Predicted Effect probably benign
Transcript: ENSMUST00000145394
Predicted Effect probably benign
Transcript: ENSMUST00000208363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208845
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,560,646 Y701H possibly damaging Het
Akap6 A G 12: 53,139,508 D1235G possibly damaging Het
Astn2 A G 4: 65,648,330 Y812H probably damaging Het
B230118H07Rik T A 2: 101,576,110 T158S probably benign Het
Bmpr1b G T 3: 141,870,796 S92* probably null Het
Camsap2 T C 1: 136,280,970 D934G probably benign Het
Cdh23 A G 10: 60,406,421 V1076A possibly damaging Het
Cdhr1 T C 14: 37,080,634 D624G possibly damaging Het
Cfap57 A T 4: 118,581,838 Y830* probably null Het
Dgcr14 A G 16: 17,911,187 V40A probably damaging Het
Eml3 A G 19: 8,940,915 D790G possibly damaging Het
Gucy2c T C 6: 136,709,832 probably null Het
Helz2 A C 2: 181,236,135 S957A probably benign Het
Ifi209 T A 1: 173,644,813 S407T probably damaging Het
Muc6 T C 7: 141,637,357 T2403A possibly damaging Het
Nfe2 T C 15: 103,249,262 N101D probably damaging Het
Nsf A T 11: 103,913,372 V178D possibly damaging Het
P4ha3 A G 7: 100,305,909 T324A probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Rhbdf1 T C 11: 32,213,432 probably null Het
Samd9l G A 6: 3,377,064 L66F probably damaging Het
Speg T C 1: 75,405,061 F1024S probably damaging Het
Sspo A G 6: 48,475,935 N2859S possibly damaging Het
Tnfrsf21 G A 17: 43,037,842 W115* probably null Het
Other mutations in A430078G23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:A430078G23Rik APN 8 3381942 missense possibly damaging 0.62
IGL01743:A430078G23Rik APN 8 3364697 missense probably benign 0.01
IGL03334:A430078G23Rik APN 8 3388023 missense probably benign 0.04
R0417:A430078G23Rik UTSW 8 3388957 utr 3 prime probably benign
R0646:A430078G23Rik UTSW 8 3386959 missense probably damaging 0.99
R0759:A430078G23Rik UTSW 8 3388822 utr 3 prime probably benign
R0980:A430078G23Rik UTSW 8 3389095 utr 3 prime probably benign
R1175:A430078G23Rik UTSW 8 3389023 utr 3 prime probably benign
R1649:A430078G23Rik UTSW 8 3389094 utr 3 prime probably benign
R1781:A430078G23Rik UTSW 8 3380495 missense probably damaging 0.98
R2211:A430078G23Rik UTSW 8 3387680 missense possibly damaging 0.95
R2843:A430078G23Rik UTSW 8 3364634 missense possibly damaging 0.82
R5319:A430078G23Rik UTSW 8 3385010 critical splice donor site probably null
R5415:A430078G23Rik UTSW 8 3388075 missense probably damaging 0.99
R5588:A430078G23Rik UTSW 8 3388878 utr 3 prime probably benign
R6455:A430078G23Rik UTSW 8 3388753 missense probably benign 0.16
R7573:A430078G23Rik UTSW 8 3384918 missense probably damaging 0.96
R7664:A430078G23Rik UTSW 8 3386390 missense probably damaging 0.98
R7731:A430078G23Rik UTSW 8 3384936 missense probably damaging 0.99
R7845:A430078G23Rik UTSW 8 3386959 missense probably damaging 0.99
R8167:A430078G23Rik UTSW 8 3353636 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CGTGACAGCATCATCCTACAATGTTCTT -3'
(R):5'- CCCTTCTCTTATTGCAGAATAAGCCCAT -3'

Sequencing Primer
(F):5'- ATCATCCTACAATGTTCTTGTGTG -3'
(R):5'- cacacacacacacacacac -3'
Posted On2013-11-07