Incidental Mutation 'R0927:Spg11'
Institutional Source Beutler Lab
Gene Symbol Spg11
Ensembl Gene ENSMUSG00000033396
Gene NameSPG11, spatacsin vesicle trafficking associated
SynonymsC530005A01Rik, 6030465E24Rik
MMRRC Submission 039074-MU
Accession Numbers

Genbank: NM_145531

Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosomal Location122053520-122118386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122094487 bp
Amino Acid Change Threonine to Serine at position 756 (T756S)
Ref Sequence ENSEMBL: ENSMUSP00000037543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036450]
Predicted Effect probably damaging
Transcript: ENSMUST00000036450
AA Change: T756S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: T756S

low complexity region 2 18 N/A INTRINSIC
low complexity region 254 276 N/A INTRINSIC
low complexity region 945 958 N/A INTRINSIC
low complexity region 1250 1264 N/A INTRINSIC
low complexity region 1305 1313 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
low complexity region 1772 1784 N/A INTRINSIC
Pfam:Spatacsin_C 2082 2374 1.1e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133145
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Spg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Spg11 APN 2 122065560 missense probably damaging 0.96
IGL00495:Spg11 APN 2 122094456 critical splice donor site probably null
IGL00757:Spg11 APN 2 122070959 missense probably benign 0.05
IGL01304:Spg11 APN 2 122072290 missense probably damaging 1.00
IGL01355:Spg11 APN 2 122113156 missense probably benign
IGL01626:Spg11 APN 2 122060971 missense probably damaging 0.98
IGL01739:Spg11 APN 2 122114671 missense probably damaging 1.00
IGL01835:Spg11 APN 2 122088224 missense probably benign 0.36
IGL02129:Spg11 APN 2 122095686 missense probably damaging 0.99
IGL02178:Spg11 APN 2 122097302 missense probably damaging 1.00
IGL02199:Spg11 APN 2 122059553 missense probably damaging 1.00
IGL02212:Spg11 APN 2 122108157 missense probably benign 0.31
IGL02605:Spg11 APN 2 122092260 missense probably benign 0.00
IGL02635:Spg11 APN 2 122113068 missense possibly damaging 0.52
IGL02743:Spg11 APN 2 122059507 missense probably damaging 0.97
IGL02822:Spg11 APN 2 122074534 missense probably damaging 0.99
IGL02992:Spg11 APN 2 122058398 missense probably damaging 1.00
IGL03010:Spg11 APN 2 122088320 missense probably damaging 0.96
3-1:Spg11 UTSW 2 122086890 missense probably damaging 0.98
PIT4354001:Spg11 UTSW 2 122088185 missense probably damaging 0.98
R0131:Spg11 UTSW 2 122070968 missense probably damaging 1.00
R0206:Spg11 UTSW 2 122055696 critical splice donor site probably null
R0208:Spg11 UTSW 2 122055696 critical splice donor site probably null
R0302:Spg11 UTSW 2 122092187 missense possibly damaging 0.90
R0347:Spg11 UTSW 2 122097369 missense probably damaging 0.99
R0357:Spg11 UTSW 2 122066232 splice site probably benign
R0372:Spg11 UTSW 2 122059447 frame shift probably null
R0715:Spg11 UTSW 2 122084983 missense probably benign 0.03
R1163:Spg11 UTSW 2 122070941 missense probably damaging 1.00
R1534:Spg11 UTSW 2 122092325 missense probably damaging 1.00
R1555:Spg11 UTSW 2 122097377 missense probably damaging 0.99
R1569:Spg11 UTSW 2 122101706 missense probably damaging 0.99
R1840:Spg11 UTSW 2 122101756 missense probably damaging 1.00
R1929:Spg11 UTSW 2 122060207 missense probably damaging 1.00
R2265:Spg11 UTSW 2 122108307 missense possibly damaging 0.48
R2303:Spg11 UTSW 2 122068837 missense probably damaging 0.99
R2510:Spg11 UTSW 2 122075310 missense probably benign 0.03
R2760:Spg11 UTSW 2 122097359 missense probably damaging 0.99
R2918:Spg11 UTSW 2 122075301 missense probably damaging 0.99
R3195:Spg11 UTSW 2 122083398 critical splice donor site probably null
R3423:Spg11 UTSW 2 122071053 missense probably benign 0.00
R4353:Spg11 UTSW 2 122113194 missense possibly damaging 0.92
R4407:Spg11 UTSW 2 122075332 missense probably benign 0.00
R4644:Spg11 UTSW 2 122061029 missense probably benign 0.03
R4663:Spg11 UTSW 2 122098099 critical splice donor site probably null
R4684:Spg11 UTSW 2 122065076 missense probably damaging 1.00
R4771:Spg11 UTSW 2 122065482 nonsense probably null
R4810:Spg11 UTSW 2 122059796 missense probably damaging 1.00
R4829:Spg11 UTSW 2 122108455 missense probably benign 0.44
R5089:Spg11 UTSW 2 122114717 nonsense probably null
R5362:Spg11 UTSW 2 122061000 missense probably damaging 0.99
R5684:Spg11 UTSW 2 122093503 missense probably damaging 1.00
R5899:Spg11 UTSW 2 122098199 missense possibly damaging 0.67
R5923:Spg11 UTSW 2 122093478 missense probably damaging 0.98
R6052:Spg11 UTSW 2 122097356 missense probably damaging 0.99
R6111:Spg11 UTSW 2 122093482 missense probably damaging 0.98
R6174:Spg11 UTSW 2 122086805 intron probably null
R6226:Spg11 UTSW 2 122088262 missense possibly damaging 0.69
R6336:Spg11 UTSW 2 122112959 unclassified probably null
R6480:Spg11 UTSW 2 122092305 missense probably benign 0.03
R6494:Spg11 UTSW 2 122113225 missense probably damaging 0.98
R6582:Spg11 UTSW 2 122092292 missense probably damaging 0.99
R6714:Spg11 UTSW 2 122095731 missense probably damaging 0.99
R6791:Spg11 UTSW 2 122093443 missense probably damaging 0.99
R6836:Spg11 UTSW 2 122059535 missense probably damaging 1.00
R6928:Spg11 UTSW 2 122069904 missense probably benign 0.37
R7179:Spg11 UTSW 2 122101789 splice site probably null
R7229:Spg11 UTSW 2 122108104 missense probably damaging 0.98
R7337:Spg11 UTSW 2 122084993 missense probably benign 0.09
R7338:Spg11 UTSW 2 122055377 missense probably damaging 1.00
R7351:Spg11 UTSW 2 122069931 missense possibly damaging 0.95
R7378:Spg11 UTSW 2 122058429 missense probably damaging 1.00
R7448:Spg11 UTSW 2 122093545 critical splice acceptor site probably null
R7505:Spg11 UTSW 2 122075351 nonsense probably null
R7665:Spg11 UTSW 2 122066267 missense probably damaging 0.99
R7685:Spg11 UTSW 2 122068880 missense probably damaging 0.99
R7779:Spg11 UTSW 2 122070939 missense probably damaging 1.00
R8024:Spg11 UTSW 2 122097321 missense possibly damaging 0.67
R8033:Spg11 UTSW 2 122086951 missense probably damaging 1.00
R8069:Spg11 UTSW 2 122113156 missense probably benign
Z1177:Spg11 UTSW 2 122072985 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agaaaccctgtctcaaaaaaacc -3'
Posted On2013-11-07