Mutagenetix > Incidental Mutations

Incidental Mutation 'R0927:Myh7b'

80471

Institutional Source

Beutler Lab

Gene Symbol

Myh7b

Ensembl Gene

ENSMUSG00000074652

Gene Name

myosin, heavy chain 7B, cardiac muscle, beta

Synonyms

Myh14

MMRRC Submission

039074-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0927 (G1)

Quality Score

206

Status

Not validated

Chromosome

Chromosomal Location

155611212-155634307 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 155620120 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 312 (D312G)

Ref Sequence

ENSEMBL: ENSMUSP00000090672 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092995]

Predicted Effect

probably damaging
Transcript: ENSMUST00000092995
AA Change: D312G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: D312G

Domain	Start	End	E-Value	Type
Pfam:Myosin_N	32	72	4.7e-14	PFAM
MYSc	78	786	N/A	SMART
IQ	787	809	2.6e0	SMART
Pfam:Myosin_tail_1	850	1931	5.5e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000102357

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.0%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	T	C	5: 24,402,319	L363P	probably damaging	Het
Adam12	T	A	7: 133,998,230	H85L	probably damaging	Het
Adam34	A	T	8: 43,651,584	H341Q	probably damaging	Het
Adam7	A	G	14: 68,516,684	L322P	probably damaging	Het
Adcy5	T	A	16: 35,156,243	S49T	probably benign	Het
Arfgap2	T	C	2: 91,273,805	S374P	probably benign	Het
Arpp19	G	A	9: 75,037,685		probably benign	Het
Baz1a	T	C	12: 54,894,988	K1478E	probably damaging	Het
Cdc27	G	T	11: 104,505,641	A812E	possibly damaging	Het
Chtf8	G	A	8: 106,885,518	T263I	probably damaging	Het
Clcn6	T	C	4: 148,029,392	N70D	probably benign	Het
Cntnap5c	A	T	17: 58,042,558	T289S	possibly damaging	Het
Dzip3	T	C	16: 48,975,477	N177S	probably damaging	Het
Edar	G	T	10: 58,629,491		probably null	Het
Enam	T	A	5: 88,494,060	N244K	possibly damaging	Het
Fbxw10	A	G	11: 62,876,944	K874E	probably damaging	Het
Glra3	A	G	8: 56,125,204	E432G	possibly damaging	Het
Gm13084	A	T	4: 143,812,808	D38E	probably benign	Het
Gm13088	T	A	4: 143,654,220	H411L	possibly damaging	Het
Gm5346	A	T	8: 43,625,123	M688K	probably benign	Het
Grin3b	G	A	10: 79,971,228	R110Q	probably benign	Het
Herc3	T	A	6: 58,868,763	V423D	possibly damaging	Het
Ifit2	A	T	19: 34,573,584	T175S	probably benign	Het
Kcnj8	T	G	6: 142,565,901	I327L	possibly damaging	Het
Kcns2	A	T	15: 34,839,096	I202F	probably benign	Het
Kif12	T	C	4: 63,168,773	R305G	possibly damaging	Het
Limch1	A	G	5: 66,997,233	D362G	probably damaging	Het
Lrba	T	C	3: 86,780,233	I2815T	probably damaging	Het
Lrrtm1	G	T	6: 77,244,860	M433I	probably damaging	Het
Nrxn1	A	T	17: 90,037,330	I382N	probably damaging	Het
Nudt6	C	T	3: 37,405,353	R161H	probably benign	Het
Olfr1490	T	A	19: 13,654,452	W8R	probably damaging	Het
Olfr734	A	T	14: 50,320,729	Y35*	probably null	Het
Olfr744	A	C	14: 50,618,587	M122L	possibly damaging	Het
Olfr857	C	T	9: 19,713,649	A274V	probably benign	Het
Pmf1	A	T	3: 88,396,062	V64D	probably damaging	Het
Pomgnt1	T	A	4: 116,151,851	V29D	probably damaging	Het
Prex1	C	T	2: 166,586,537	A925T	probably benign	Het
Pus3	A	G	9: 35,565,031	Y72C	probably damaging	Het
Rnf20	T	C	4: 49,642,176	S247P	probably damaging	Het
Rnf213	T	A	11: 119,414,570	D542E	probably benign	Het
Sidt1	T	C	16: 44,243,532	D786G	probably benign	Het
Sirt6	A	T	10: 81,622,641	D219E	probably damaging	Het
Slc36a2	A	T	11: 55,181,585	I67N	probably damaging	Het
Slc47a1	A	G	11: 61,373,422	F57S	probably damaging	Het
Spg11	T	A	2: 122,094,487	T756S	probably damaging	Het
Sptbn1	C	A	11: 30,121,591	R1447L	probably damaging	Het
Tcf7l2	A	G	19: 55,918,955	M340V	probably damaging	Het
Thap1	T	C	8: 26,162,705	V157A	probably benign	Het
Ubash3b	G	A	9: 41,023,557	Q354*	probably null	Het
Ubtd1	G	A	19: 42,032,021	W68*	probably null	Het
Wdr64	G	T	1: 175,793,081	R793L	probably damaging	Het
Zbtb24	C	T	10: 41,451,436	T106I	probably benign	Het
Zbtb26	T	C	2: 37,436,325	N233S	possibly damaging	Het
Zcchc24	A	T	14: 25,757,161	N99K	possibly damaging	Het

Other mutations in Myh7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00931:Myh7b	APN	2	155630292	missense	probably damaging	0.99
IGL01604:Myh7b	APN	2	155632407	missense	probably damaging	0.96
IGL02179:Myh7b	APN	2	155614491	missense	probably benign	0.02
IGL02729:Myh7b	APN	2	155625689	missense	probably damaging	1.00
IGL02804:Myh7b	APN	2	155625723	missense	probably damaging	1.00
IGL02851:Myh7b	APN	2	155628827	missense	probably damaging	1.00
IGL02956:Myh7b	APN	2	155632903	missense	probably damaging	1.00
IGL02956:Myh7b	APN	2	155625954	missense	possibly damaging	0.95
IGL02992:Myh7b	APN	2	155621410	missense	probably damaging	0.99
IGL03060:Myh7b	APN	2	155632751	missense	probably damaging	1.00
IGL03061:Myh7b	APN	2	155620111	missense	possibly damaging	0.93
IGL03226:Myh7b	APN	2	155620483	nonsense	probably null
IGL03246:Myh7b	APN	2	155617872	missense	probably damaging	1.00
IGL03382:Myh7b	APN	2	155623479	missense	probably damaging	1.00
euclidian	UTSW	2	155633399	missense	probably benign	0.32
imaginary	UTSW	2	155632255	missense	probably benign	0.36
Irrational	UTSW	2	155630672	unclassified	probably benign
Muscoli	UTSW	2	155620118	nonsense	probably null
R0015:Myh7b	UTSW	2	155622286	missense	probably damaging	1.00
R0015:Myh7b	UTSW	2	155622286	missense	probably damaging	1.00
R0109:Myh7b	UTSW	2	155611674	missense	possibly damaging	0.92
R0309:Myh7b	UTSW	2	155630672	unclassified	probably benign
R0567:Myh7b	UTSW	2	155626398	missense	probably damaging	1.00
R0619:Myh7b	UTSW	2	155611722	missense	probably benign	0.00
R0973:Myh7b	UTSW	2	155620427	missense	probably benign
R0973:Myh7b	UTSW	2	155620427	missense	probably benign
R0974:Myh7b	UTSW	2	155620427	missense	probably benign
R1137:Myh7b	UTSW	2	155622714	missense	probably damaging	1.00
R1261:Myh7b	UTSW	2	155621083	missense	probably benign	0.00
R1268:Myh7b	UTSW	2	155614046	nonsense	probably null
R1537:Myh7b	UTSW	2	155631787	missense	probably damaging	0.96
R1632:Myh7b	UTSW	2	155620525	missense	probably benign	0.04
R1694:Myh7b	UTSW	2	155613193	missense	probably damaging	0.99
R1697:Myh7b	UTSW	2	155620134	missense	probably damaging	1.00
R1730:Myh7b	UTSW	2	155625672	missense	possibly damaging	0.73
R1762:Myh7b	UTSW	2	155630858	missense	probably damaging	0.96
R1783:Myh7b	UTSW	2	155625672	missense	possibly damaging	0.73
R2105:Myh7b	UTSW	2	155629457	missense	probably benign	0.00
R2140:Myh7b	UTSW	2	155620123	missense	probably damaging	1.00
R2971:Myh7b	UTSW	2	155632255	missense	probably benign	0.36
R3838:Myh7b	UTSW	2	155632989	missense	probably damaging	1.00
R4074:Myh7b	UTSW	2	155618758	missense	probably damaging	0.96
R4191:Myh7b	UTSW	2	155633399	missense	probably benign	0.32
R4689:Myh7b	UTSW	2	155630514	missense	possibly damaging	0.75
R4695:Myh7b	UTSW	2	155614177	missense	probably damaging	1.00
R4697:Myh7b	UTSW	2	155629322	missense	probably damaging	1.00
R4771:Myh7b	UTSW	2	155626394	nonsense	probably null
R4794:Myh7b	UTSW	2	155623266	missense	probably benign	0.00
R4842:Myh7b	UTSW	2	155633989	missense	probably benign	0.45
R4871:Myh7b	UTSW	2	155613500	missense	probably benign	0.18
R5022:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5023:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5025:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5050:Myh7b	UTSW	2	155631750	missense	probably benign	0.00
R5055:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5056:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5161:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5284:Myh7b	UTSW	2	155632314	missense	probably benign
R5422:Myh7b	UTSW	2	155631034	missense	probably damaging	0.99
R5505:Myh7b	UTSW	2	155632672	missense	probably benign	0.01
R5946:Myh7b	UTSW	2	155621395	missense	probably damaging	1.00
R6089:Myh7b	UTSW	2	155622489	missense	probably damaging	1.00
R6103:Myh7b	UTSW	2	155618743	missense	probably damaging	1.00
R6233:Myh7b	UTSW	2	155631799	missense	possibly damaging	0.85
R6292:Myh7b	UTSW	2	155632396	missense	probably damaging	1.00
R6350:Myh7b	UTSW	2	155628760	missense	probably benign	0.00
R6484:Myh7b	UTSW	2	155628643	missense	probably benign	0.05
R6760:Myh7b	UTSW	2	155620118	nonsense	probably null
R6896:Myh7b	UTSW	2	155622568	critical splice donor site	probably null
R6945:Myh7b	UTSW	2	155622232	missense	possibly damaging	0.95
R7020:Myh7b	UTSW	2	155631751	missense	possibly damaging	0.56
R7052:Myh7b	UTSW	2	155614133	missense	probably damaging	1.00
R7102:Myh7b	UTSW	2	155622199	missense	probably damaging	1.00
R7248:Myh7b	UTSW	2	155622186	missense	probably damaging	1.00
R7303:Myh7b	UTSW	2	155618740	missense	probably damaging	1.00
R7360:Myh7b	UTSW	2	155632540	missense	probably benign	0.38
R7652:Myh7b	UTSW	2	155632236	missense	probably damaging	0.99
R7678:Myh7b	UTSW	2	155617778	splice site	probably null
R7703:Myh7b	UTSW	2	155620436	missense	probably null	1.00
R7711:Myh7b	UTSW	2	155620403	missense	probably damaging	1.00
R7923:Myh7b	UTSW	2	155625966	missense	probably benign
R7967:Myh7b	UTSW	2	155614199	splice site	probably null
R8045:Myh7b	UTSW	2	155613181	missense	probably benign	0.00
R8176:Myh7b	UTSW	2	155625966	missense	probably benign	0.06
R8272:Myh7b	UTSW	2	155632904	missense	probably damaging	1.00
X0013:Myh7b	UTSW	2	155631169	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGCTCAGGTTACAGAGAAGCCC -3'
(R):5'- TATGAGTCCTTGAGAGTCTCGCCG -3'

Sequencing Primer
(F):5'- AGGCTCAAGACTCTCTCTGA -3'
(R):5'- ATACTAATTCCCCGGTCTCGAC -3'

Posted On

2013-11-07