Incidental Mutation 'R0880:Rhbdf1'
ID80474
Institutional Source Beutler Lab
Gene Symbol Rhbdf1
Ensembl Gene ENSMUSG00000020282
Gene Namerhomboid 5 homolog 1
SynonymsDist, Dist1, Egfr-rs
MMRRC Submission 039047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R0880 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location32209585-32222300 bp(-) (GRCm38)
Type of Mutationunclassified (1636 bp from exon)
DNA Base Change (assembly) T to C at 32213432 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020524] [ENSMUST00000039601] [ENSMUST00000121182] [ENSMUST00000132578] [ENSMUST00000143988] [ENSMUST00000144902] [ENSMUST00000146179] [ENSMUST00000150381]
Predicted Effect probably benign
Transcript: ENSMUST00000020524
AA Change: S347G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000020524
Gene: ENSMUSG00000020282
AA Change: S347G

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 308 1.6e-116 PFAM
Pfam:Rhomboid 648 792 2.1e-32 PFAM
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039601
SMART Domains Protein: ENSMUSP00000046654
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 123 4e-63 PDB
Blast:UBQ 32 119 1e-30 BLAST
SCOP:d1euvb_ 32 121 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121182
SMART Domains Protein: ENSMUSP00000112483
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 83 4e-28 PDB
Blast:UBQ 32 83 2e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125837
Predicted Effect probably benign
Transcript: ENSMUST00000132578
SMART Domains Protein: ENSMUSP00000120543
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 158 7.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143036
Predicted Effect probably benign
Transcript: ENSMUST00000143988
SMART Domains Protein: ENSMUSP00000117471
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
Pfam:Rhomboid 52 167 1.6e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000144902
SMART Domains Protein: ENSMUSP00000122533
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146179
SMART Domains Protein: ENSMUSP00000118985
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 155 7.1e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000150381
SMART Domains Protein: ENSMUSP00000118769
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show pleiotropic phenotypes and postnatal lethality largely dependent on the genetic background. Observed defects range from small size, reduced fat mass, and brain haemorrhages to small lymph organs, thrombosis, abnormal pancreatic acini, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,560,646 Y701H possibly damaging Het
A430078G23Rik A G 8: 3,389,032 probably benign Het
Akap6 A G 12: 53,139,508 D1235G possibly damaging Het
Astn2 A G 4: 65,648,330 Y812H probably damaging Het
B230118H07Rik T A 2: 101,576,110 T158S probably benign Het
Bmpr1b G T 3: 141,870,796 S92* probably null Het
Camsap2 T C 1: 136,280,970 D934G probably benign Het
Cdh23 A G 10: 60,406,421 V1076A possibly damaging Het
Cdhr1 T C 14: 37,080,634 D624G possibly damaging Het
Cfap57 A T 4: 118,581,838 Y830* probably null Het
Dgcr14 A G 16: 17,911,187 V40A probably damaging Het
Eml3 A G 19: 8,940,915 D790G possibly damaging Het
Gucy2c T C 6: 136,709,832 probably null Het
Helz2 A C 2: 181,236,135 S957A probably benign Het
Ifi209 T A 1: 173,644,813 S407T probably damaging Het
Muc6 T C 7: 141,637,357 T2403A possibly damaging Het
Nfe2 T C 15: 103,249,262 N101D probably damaging Het
Nsf A T 11: 103,913,372 V178D possibly damaging Het
P4ha3 A G 7: 100,305,909 T324A probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Samd9l G A 6: 3,377,064 L66F probably damaging Het
Speg T C 1: 75,405,061 F1024S probably damaging Het
Sspo A G 6: 48,475,935 N2859S possibly damaging Het
Tnfrsf21 G A 17: 43,037,842 W115* probably null Het
Other mutations in Rhbdf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Rhbdf1 APN 11 32213484 missense probably benign
IGL02183:Rhbdf1 APN 11 32210543 missense probably damaging 1.00
IGL02793:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
IGL02875:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
BB005:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
BB015:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
FR4589:Rhbdf1 UTSW 11 32214391 unclassified probably benign
R0071:Rhbdf1 UTSW 11 32210498 missense probably damaging 1.00
R0180:Rhbdf1 UTSW 11 32210042 missense possibly damaging 0.76
R0512:Rhbdf1 UTSW 11 32210875 nonsense probably null
R0843:Rhbdf1 UTSW 11 32215053 missense probably damaging 1.00
R1952:Rhbdf1 UTSW 11 32214277 nonsense probably null
R2017:Rhbdf1 UTSW 11 32210471 missense probably damaging 1.00
R2076:Rhbdf1 UTSW 11 32214088 missense probably benign 0.01
R3032:Rhbdf1 UTSW 11 32209985 missense probably damaging 1.00
R4355:Rhbdf1 UTSW 11 32216236 missense probably damaging 1.00
R4429:Rhbdf1 UTSW 11 32213369 missense probably benign 0.00
R4865:Rhbdf1 UTSW 11 32214517 missense probably damaging 1.00
R5585:Rhbdf1 UTSW 11 32210222 unclassified probably null
R5728:Rhbdf1 UTSW 11 32209901 unclassified probably null
R5925:Rhbdf1 UTSW 11 32212906 missense probably benign 0.24
R5940:Rhbdf1 UTSW 11 32209847 missense probably benign 0.00
R6083:Rhbdf1 UTSW 11 32210066 missense probably damaging 1.00
R6088:Rhbdf1 UTSW 11 32212007 missense possibly damaging 0.62
R6361:Rhbdf1 UTSW 11 32212915 missense possibly damaging 0.92
R6692:Rhbdf1 UTSW 11 32215652 missense probably damaging 0.98
R6727:Rhbdf1 UTSW 11 32214042 missense possibly damaging 0.78
R6825:Rhbdf1 UTSW 11 32209970 missense probably damaging 1.00
R7589:Rhbdf1 UTSW 11 32212903 missense probably benign 0.01
R7928:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
R7940:Rhbdf1 UTSW 11 32216258 start codon destroyed possibly damaging 0.79
R7957:Rhbdf1 UTSW 11 32210523 missense probably damaging 1.00
R8220:Rhbdf1 UTSW 11 32214563 missense probably benign 0.30
V3553:Rhbdf1 UTSW 11 32211583 missense probably damaging 1.00
Z1176:Rhbdf1 UTSW 11 32215125 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCATAGATGCACACAGCCAG -3'
(R):5'- TTCTGCCCAAGAGAGAAGGCAGTG -3'

Sequencing Primer
(F):5'- AGCGTCCTGACATGGATTCC -3'
(R):5'- CAGTGTATAGGTTCCAGGCAG -3'
Posted On2013-11-07