Incidental Mutation 'R0927:Nudt6'
ID80475
Institutional Source Beutler Lab
Gene Symbol Nudt6
Ensembl Gene ENSMUSG00000050174
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 6
Synonyms
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location37404910-37420211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37405353 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 161 (R161H)
Ref Sequence ENSEMBL: ENSMUSP00000103753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038885] [ENSMUST00000052645] [ENSMUST00000091203] [ENSMUST00000099130] [ENSMUST00000108117] [ENSMUST00000108118] [ENSMUST00000108120] [ENSMUST00000138563] [ENSMUST00000141438] [ENSMUST00000146324] [ENSMUST00000149449] [ENSMUST00000200585]
Predicted Effect probably benign
Transcript: ENSMUST00000038885
SMART Domains Protein: ENSMUSP00000037694
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 25 151 2.08e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052645
AA Change: R229H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056219
Gene: ENSMUSG00000050174
AA Change: R229H

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 1e-42 PDB
Pfam:NUDIX 139 270 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091203
SMART Domains Protein: ENSMUSP00000088742
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 3 109 3.67e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099130
AA Change: R228H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096733
Gene: ENSMUSG00000050174
AA Change: R228H

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 1e-42 PDB
Pfam:NUDIX 139 269 7.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108117
SMART Domains Protein: ENSMUSP00000103752
Gene: ENSMUSG00000050174

DomainStartEndE-ValueType
PDB:3FXT|H 42 76 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108118
AA Change: R161H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000103753
Gene: ENSMUSG00000050174
AA Change: R161H

DomainStartEndE-ValueType
Pfam:NUDIX 73 202 1.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108120
SMART Domains Protein: ENSMUSP00000103755
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 3 106 3.19e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133894
Predicted Effect probably benign
Transcript: ENSMUST00000138563
SMART Domains Protein: ENSMUSP00000122227
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 25 151 2.08e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138710
Predicted Effect probably benign
Transcript: ENSMUST00000141438
AA Change: R13H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142588
Gene: ENSMUSG00000050174
AA Change: R13H

DomainStartEndE-ValueType
PDB:3H95|A 2 97 5e-55 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145228
Predicted Effect probably benign
Transcript: ENSMUST00000146324
AA Change: R63H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142653
Gene: ENSMUSG00000050174
AA Change: R63H

DomainStartEndE-ValueType
Pfam:NUDIX 1 104 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149449
SMART Domains Protein: ENSMUSP00000116572
Gene: ENSMUSG00000050174

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 3e-44 PDB
PDB:3H95|A 132 191 6e-22 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150021
Predicted Effect probably benign
Transcript: ENSMUST00000198158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199938
Predicted Effect probably benign
Transcript: ENSMUST00000200585
SMART Domains Protein: ENSMUSP00000143094
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 25 151 2.08e-65 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene overlaps and lies on the opposite strand from FGF2 gene, and is thought to be the FGF2 antisense gene. The two genes are independently transcribed, and their expression shows an inverse relationship, suggesting that this antisense transcript may regulate FGF2 expression. This gene has also been shown to have hormone-regulatory and antiproliferative actions in the pituitary that are independent of FGF2 expression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Nudt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Nudt6 APN 3 37405171 missense probably benign 0.03
IGL02965:Nudt6 APN 3 37419506 missense probably damaging 0.99
IGL02975:Nudt6 APN 3 37419518 missense probably damaging 1.00
R1884:Nudt6 UTSW 3 37412400 missense probably benign 0.02
R1939:Nudt6 UTSW 3 37405230 missense probably damaging 1.00
R2122:Nudt6 UTSW 3 37412405 missense probably benign 0.01
R4416:Nudt6 UTSW 3 37405229 unclassified probably null
R4801:Nudt6 UTSW 3 37405354 missense probably benign 0.01
R4802:Nudt6 UTSW 3 37405354 missense probably benign 0.01
R5826:Nudt6 UTSW 3 37419468 missense probably benign 0.05
R6362:Nudt6 UTSW 3 37419489 missense possibly damaging 0.66
R7887:Nudt6 UTSW 3 37412380 missense possibly damaging 0.95
R7970:Nudt6 UTSW 3 37412380 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGCAGCTCCCTGTGATAGAGTTTG -3'
(R):5'- ACTCCGGCAGTTTGATGGAAGC -3'

Sequencing Primer
(F):5'- CTCCCTGTGATAGAGTTTGTAGAAC -3'
(R):5'- GGATGAAATCTTTAtgtttgtgtgtg -3'
Posted On2013-11-07