Mutagenetix > Incidental Mutation

Incidental Mutation 'R0927:Rnf20'

80483

Institutional Source

Beutler Lab

Gene Symbol

Rnf20

Ensembl Gene

ENSMUSG00000028309

Gene Name

ring finger protein 20

Synonyms

4833430L21Rik

MMRRC Submission

039074-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0927 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49632006-49656887 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49642176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 247 (S247P)

Ref Sequence

ENSEMBL: ENSMUSP00000118293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000140341] [ENSMUST00000146547] [ENSMUST00000156314] [ENSMUST00000167496]

AlphaFold

Q5DTM8

Predicted Effect

probably damaging
Transcript: ENSMUST00000029989
AA Change: S247P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: S247P

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126675

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132782

Predicted Effect

probably benign
Transcript: ENSMUST00000140341

SMART Domains

Protein: ENSMUSP00000121334
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146547

SMART Domains

Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149862

Predicted Effect

probably damaging
Transcript: ENSMUST00000156314
AA Change: S247P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309
AA Change: S247P

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC
SCOP:d1gw5a_	174	294	3e-3	SMART
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	606	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167496
AA Change: S247P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: S247P

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.0%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	T	C	5: 24,402,319	L363P	probably damaging	Het
Adam12	T	A	7: 133,998,230	H85L	probably damaging	Het
Adam34	A	T	8: 43,651,584	H341Q	probably damaging	Het
Adam7	A	G	14: 68,516,684	L322P	probably damaging	Het
Adcy5	T	A	16: 35,156,243	S49T	probably benign	Het
Arfgap2	T	C	2: 91,273,805	S374P	probably benign	Het
Arpp19	G	A	9: 75,037,685		probably benign	Het
Baz1a	T	C	12: 54,894,988	K1478E	probably damaging	Het
Cdc27	G	T	11: 104,505,641	A812E	possibly damaging	Het
Chtf8	G	A	8: 106,885,518	T263I	probably damaging	Het
Clcn6	T	C	4: 148,029,392	N70D	probably benign	Het
Cntnap5c	A	T	17: 58,042,558	T289S	possibly damaging	Het
Dzip3	T	C	16: 48,975,477	N177S	probably damaging	Het
Edar	G	T	10: 58,629,491		probably null	Het
Enam	T	A	5: 88,494,060	N244K	possibly damaging	Het
Fbxw10	A	G	11: 62,876,944	K874E	probably damaging	Het
Glra3	A	G	8: 56,125,204	E432G	possibly damaging	Het
Gm13084	A	T	4: 143,812,808	D38E	probably benign	Het
Gm13088	T	A	4: 143,654,220	H411L	possibly damaging	Het
Gm5346	A	T	8: 43,625,123	M688K	probably benign	Het
Grin3b	G	A	10: 79,971,228	R110Q	probably benign	Het
Herc3	T	A	6: 58,868,763	V423D	possibly damaging	Het
Ifit2	A	T	19: 34,573,584	T175S	probably benign	Het
Kcnj8	T	G	6: 142,565,901	I327L	possibly damaging	Het
Kcns2	A	T	15: 34,839,096	I202F	probably benign	Het
Kif12	T	C	4: 63,168,773	R305G	possibly damaging	Het
Limch1	A	G	5: 66,997,233	D362G	probably damaging	Het
Lrba	T	C	3: 86,780,233	I2815T	probably damaging	Het
Lrrtm1	G	T	6: 77,244,860	M433I	probably damaging	Het
Myh7b	A	G	2: 155,620,120	D312G	probably damaging	Het
Nrxn1	A	T	17: 90,037,330	I382N	probably damaging	Het
Nudt6	C	T	3: 37,405,353	R161H	probably benign	Het
Olfr1490	T	A	19: 13,654,452	W8R	probably damaging	Het
Olfr734	A	T	14: 50,320,729	Y35*	probably null	Het
Olfr744	A	C	14: 50,618,587	M122L	possibly damaging	Het
Olfr857	C	T	9: 19,713,649	A274V	probably benign	Het
Pmf1	A	T	3: 88,396,062	V64D	probably damaging	Het
Pomgnt1	T	A	4: 116,151,851	V29D	probably damaging	Het
Prex1	C	T	2: 166,586,537	A925T	probably benign	Het
Pus3	A	G	9: 35,565,031	Y72C	probably damaging	Het
Rnf213	T	A	11: 119,414,570	D542E	probably benign	Het
Sidt1	T	C	16: 44,243,532	D786G	probably benign	Het
Sirt6	A	T	10: 81,622,641	D219E	probably damaging	Het
Slc36a2	A	T	11: 55,181,585	I67N	probably damaging	Het
Slc47a1	A	G	11: 61,373,422	F57S	probably damaging	Het
Spg11	T	A	2: 122,094,487	T756S	probably damaging	Het
Sptbn1	C	A	11: 30,121,591	R1447L	probably damaging	Het
Tcf7l2	A	G	19: 55,918,955	M340V	probably damaging	Het
Thap1	T	C	8: 26,162,705	V157A	probably benign	Het
Ubash3b	G	A	9: 41,023,557	Q354*	probably null	Het
Ubtd1	G	A	19: 42,032,021	W68*	probably null	Het
Wdr64	G	T	1: 175,793,081	R793L	probably damaging	Het
Zbtb24	C	T	10: 41,451,436	T106I	probably benign	Het
Zbtb26	T	C	2: 37,436,325	N233S	possibly damaging	Het
Zcchc24	A	T	14: 25,757,161	N99K	possibly damaging	Het

Other mutations in Rnf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rnf20	APN	4	49655480	nonsense	probably null
IGL01319:Rnf20	APN	4	49649326	missense	probably damaging	0.99
IGL01666:Rnf20	APN	4	49654486	nonsense	probably null
IGL01975:Rnf20	APN	4	49654473	missense	probably benign	0.00
IGL02130:Rnf20	APN	4	49644481	splice site	probably benign
IGL02179:Rnf20	APN	4	49638712	missense	probably benign	0.04
IGL03096:Rnf20	APN	4	49638615	splice site	probably benign
IGL03120:Rnf20	APN	4	49649955	splice site	probably benign
IGL03208:Rnf20	APN	4	49645706	splice site	probably benign
IGL03257:Rnf20	APN	4	49645687	missense	probably benign	0.19
IGL03349:Rnf20	APN	4	49655936	missense	probably damaging	1.00
R0372:Rnf20	UTSW	4	49650176	missense	possibly damaging	0.53
R0486:Rnf20	UTSW	4	49645907	missense	possibly damaging	0.57
R0791:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R1256:Rnf20	UTSW	4	49638230	missense	probably benign	0.33
R1272:Rnf20	UTSW	4	49651496	missense	probably damaging	0.99
R1460:Rnf20	UTSW	4	49645873	splice site	probably benign
R1522:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R1698:Rnf20	UTSW	4	49651498	nonsense	probably null
R1848:Rnf20	UTSW	4	49644628	missense	probably damaging	1.00
R2214:Rnf20	UTSW	4	49648344	missense	possibly damaging	0.77
R2497:Rnf20	UTSW	4	49652676	splice site	probably null
R2915:Rnf20	UTSW	4	49638769	missense	probably benign	0.13
R4726:Rnf20	UTSW	4	49654579	nonsense	probably null
R4770:Rnf20	UTSW	4	49633412	critical splice donor site	probably null
R4799:Rnf20	UTSW	4	49649962	critical splice acceptor site	probably null
R4960:Rnf20	UTSW	4	49638029	missense	probably damaging	0.99
R5022:Rnf20	UTSW	4	49642016	intron	probably benign
R5146:Rnf20	UTSW	4	49651456	missense	probably benign	0.21
R5379:Rnf20	UTSW	4	49652639	missense	possibly damaging	0.47
R5423:Rnf20	UTSW	4	49644620	missense	probably damaging	0.99
R6297:Rnf20	UTSW	4	49642132	missense	probably damaging	1.00
R6608:Rnf20	UTSW	4	49650051	missense	probably benign	0.05
R7064:Rnf20	UTSW	4	49644580	nonsense	probably null
R7776:Rnf20	UTSW	4	49644592	nonsense	probably null
R8735:Rnf20	UTSW	4	49655964	missense	possibly damaging	0.95
R8995:Rnf20	UTSW	4	49648437	missense	possibly damaging	0.94
R9599:Rnf20	UTSW	4	49638751	missense	probably benign	0.00
R9661:Rnf20	UTSW	4	49654556	missense	probably damaging	0.99
Z1177:Rnf20	UTSW	4	49645655	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCCATCAGGTTGATGCTTTGATGC -3'
(R):5'- TTCACCATTGCAGAAGCCTCCC -3'

Sequencing Primer
(F):5'- ATCAGGTTGATGCTTTGATGCAATAG -3'
(R):5'- TGTGGCATTTCTTCACAATGATG -3'

Posted On

2013-11-07