Incidental Mutation 'R0880:Nfe2'
ID80484
Institutional Source Beutler Lab
Gene Symbol Nfe2
Ensembl Gene ENSMUSG00000058794
Gene Namenuclear factor, erythroid derived 2
Synonymsp45nf-e2, p45NFE2, p45, NF-E2
MMRRC Submission 039047-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0880 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location103248212-103258403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103249262 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 101 (N101D)
Ref Sequence ENSEMBL: ENSMUSP00000120256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036004] [ENSMUST00000075192] [ENSMUST00000087351] [ENSMUST00000131364] [ENSMUST00000132438] [ENSMUST00000132836] [ENSMUST00000133600] [ENSMUST00000134193] [ENSMUST00000134554] [ENSMUST00000149111] [ENSMUST00000154510] [ENSMUST00000156927] [ENSMUST00000230171] [ENSMUST00000231141] [ENSMUST00000230489]
Predicted Effect probably benign
Transcript: ENSMUST00000036004
SMART Domains Protein: ENSMUSP00000042658
Gene: ENSMUSG00000046434

DomainStartEndE-ValueType
RRM 15 87 6.44e-27 SMART
RRM 106 178 6.86e-22 SMART
low complexity region 190 321 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075192
AA Change: N101D

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074684
Gene: ENSMUSG00000058794
AA Change: N101D

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
BRLZ 264 328 6.56e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087351
SMART Domains Protein: ENSMUSP00000084609
Gene: ENSMUSG00000046434

DomainStartEndE-ValueType
RRM 15 87 6.44e-27 SMART
RRM 106 178 6.86e-22 SMART
Pfam:HnRNPA1 257 292 4e-18 PFAM
low complexity region 303 317 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131364
AA Change: N101D

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116158
Gene: ENSMUSG00000058794
AA Change: N101D

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132438
SMART Domains Protein: ENSMUSP00000116079
Gene: ENSMUSG00000058794

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132836
AA Change: N101D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120256
Gene: ENSMUSG00000058794
AA Change: N101D

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133600
AA Change: N124D

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121817
Gene: ENSMUSG00000058794
AA Change: N124D

DomainStartEndE-ValueType
low complexity region 76 91 N/A INTRINSIC
BRLZ 287 351 6.56e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134193
AA Change: N101D

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123064
Gene: ENSMUSG00000058794
AA Change: N101D

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134554
AA Change: N101D

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117474
Gene: ENSMUSG00000058794
AA Change: N101D

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
BRLZ 264 328 6.56e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149111
AA Change: N101D

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122476
Gene: ENSMUSG00000058794
AA Change: N101D

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
BRLZ 264 328 6.56e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154510
AA Change: N101D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116678
Gene: ENSMUSG00000058794
AA Change: N101D

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156927
AA Change: N101D

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114160
Gene: ENSMUSG00000058794
AA Change: N101D

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
BRLZ 264 328 6.56e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230171
Predicted Effect probably benign
Transcript: ENSMUST00000231141
Predicted Effect probably benign
Transcript: ENSMUST00000230489
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation lack platelets and most die as neonates from internal bleeding. Survivors exhibit hypochromia, reticulocytosis, and splenomegaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,560,646 Y701H possibly damaging Het
A430078G23Rik A G 8: 3,389,032 probably benign Het
Akap6 A G 12: 53,139,508 D1235G possibly damaging Het
Astn2 A G 4: 65,648,330 Y812H probably damaging Het
B230118H07Rik T A 2: 101,576,110 T158S probably benign Het
Bmpr1b G T 3: 141,870,796 S92* probably null Het
Camsap2 T C 1: 136,280,970 D934G probably benign Het
Cdh23 A G 10: 60,406,421 V1076A possibly damaging Het
Cdhr1 T C 14: 37,080,634 D624G possibly damaging Het
Cfap57 A T 4: 118,581,838 Y830* probably null Het
Dgcr14 A G 16: 17,911,187 V40A probably damaging Het
Eml3 A G 19: 8,940,915 D790G possibly damaging Het
Gucy2c T C 6: 136,709,832 probably null Het
Helz2 A C 2: 181,236,135 S957A probably benign Het
Ifi209 T A 1: 173,644,813 S407T probably damaging Het
Muc6 T C 7: 141,637,357 T2403A possibly damaging Het
Nsf A T 11: 103,913,372 V178D possibly damaging Het
P4ha3 A G 7: 100,305,909 T324A probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Rhbdf1 T C 11: 32,213,432 probably null Het
Samd9l G A 6: 3,377,064 L66F probably damaging Het
Speg T C 1: 75,405,061 F1024S probably damaging Het
Sspo A G 6: 48,475,935 N2859S possibly damaging Het
Tnfrsf21 G A 17: 43,037,842 W115* probably null Het
Other mutations in Nfe2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Nfe2 APN 15 103249180 missense probably damaging 1.00
nevio UTSW 15 103248805 missense probably damaging 1.00
R0515:Nfe2 UTSW 15 103249427 missense probably null 0.00
R1613:Nfe2 UTSW 15 103249129 missense probably damaging 1.00
R4049:Nfe2 UTSW 15 103250937 missense possibly damaging 0.93
R4594:Nfe2 UTSW 15 103248805 missense probably damaging 1.00
R5523:Nfe2 UTSW 15 103249129 missense probably damaging 1.00
R6263:Nfe2 UTSW 15 103250951 missense probably damaging 0.96
Z1177:Nfe2 UTSW 15 103248557 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AACTGGACCGGAGGATGACTCTAAG -3'
(R):5'- TTTTGAGCCTCAAGCACCCACC -3'

Sequencing Primer
(F):5'- GGATACTCCACTGGGTACATGTC -3'
(R):5'- CCCATACCCTGGGCCAC -3'
Posted On2013-11-07