Mutagenetix > Incidental Mutations

Incidental Mutation 'R0927:Kif12'

80485

Institutional Source

Beutler Lab

Gene Symbol

Kif12

Ensembl Gene

ENSMUSG00000028357

Gene Name

kinesin family member 12

Synonyms

N-9 kinesin

MMRRC Submission

039074-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.254) question?

Stock #

R0927 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63165630-63172131 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63168773 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 305 (R305G)

Ref Sequence

ENSEMBL: ENSMUSP00000030042 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030042] [ENSMUST00000124739] [ENSMUST00000156618]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030042
AA Change: R305G

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000030042
Gene: ENSMUSG00000028357
AA Change: R305G

Domain	Start	End	E-Value	Type
KISc	23	368	4.46e-108	SMART
coiled coil region	376	464	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124739

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131760

Predicted Effect

probably benign
Transcript: ENSMUST00000154234

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156618
AA Change: R305G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.0%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily of microtubule-associated molecular motors with functions related to the microtubule cytosekelton. Members of this superfamily play important roles in intracellular transport and cell division. A similar protein in mouse functions in the beta cell antioxidant signaling cascade, acting as a scaffold for the transcription factor specificity protein 1 (Sp1). Mice that lack this gene exhibit beta cell oxidative stress resulting in hypoinsulinemic glucose intolerance. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	T	C	5: 24,402,319	L363P	probably damaging	Het
Adam12	T	A	7: 133,998,230	H85L	probably damaging	Het
Adam34	A	T	8: 43,651,584	H341Q	probably damaging	Het
Adam7	A	G	14: 68,516,684	L322P	probably damaging	Het
Adcy5	T	A	16: 35,156,243	S49T	probably benign	Het
Arfgap2	T	C	2: 91,273,805	S374P	probably benign	Het
Arpp19	G	A	9: 75,037,685		probably benign	Het
Baz1a	T	C	12: 54,894,988	K1478E	probably damaging	Het
Cdc27	G	T	11: 104,505,641	A812E	possibly damaging	Het
Chtf8	G	A	8: 106,885,518	T263I	probably damaging	Het
Clcn6	T	C	4: 148,029,392	N70D	probably benign	Het
Cntnap5c	A	T	17: 58,042,558	T289S	possibly damaging	Het
Dzip3	T	C	16: 48,975,477	N177S	probably damaging	Het
Edar	G	T	10: 58,629,491		probably null	Het
Enam	T	A	5: 88,494,060	N244K	possibly damaging	Het
Fbxw10	A	G	11: 62,876,944	K874E	probably damaging	Het
Glra3	A	G	8: 56,125,204	E432G	possibly damaging	Het
Gm13084	A	T	4: 143,812,808	D38E	probably benign	Het
Gm13088	T	A	4: 143,654,220	H411L	possibly damaging	Het
Gm5346	A	T	8: 43,625,123	M688K	probably benign	Het
Grin3b	G	A	10: 79,971,228	R110Q	probably benign	Het
Herc3	T	A	6: 58,868,763	V423D	possibly damaging	Het
Ifit2	A	T	19: 34,573,584	T175S	probably benign	Het
Kcnj8	T	G	6: 142,565,901	I327L	possibly damaging	Het
Kcns2	A	T	15: 34,839,096	I202F	probably benign	Het
Limch1	A	G	5: 66,997,233	D362G	probably damaging	Het
Lrba	T	C	3: 86,780,233	I2815T	probably damaging	Het
Lrrtm1	G	T	6: 77,244,860	M433I	probably damaging	Het
Myh7b	A	G	2: 155,620,120	D312G	probably damaging	Het
Nrxn1	A	T	17: 90,037,330	I382N	probably damaging	Het
Nudt6	C	T	3: 37,405,353	R161H	probably benign	Het
Olfr1490	T	A	19: 13,654,452	W8R	probably damaging	Het
Olfr734	A	T	14: 50,320,729	Y35*	probably null	Het
Olfr744	A	C	14: 50,618,587	M122L	possibly damaging	Het
Olfr857	C	T	9: 19,713,649	A274V	probably benign	Het
Pmf1	A	T	3: 88,396,062	V64D	probably damaging	Het
Pomgnt1	T	A	4: 116,151,851	V29D	probably damaging	Het
Prex1	C	T	2: 166,586,537	A925T	probably benign	Het
Pus3	A	G	9: 35,565,031	Y72C	probably damaging	Het
Rnf20	T	C	4: 49,642,176	S247P	probably damaging	Het
Rnf213	T	A	11: 119,414,570	D542E	probably benign	Het
Sidt1	T	C	16: 44,243,532	D786G	probably benign	Het
Sirt6	A	T	10: 81,622,641	D219E	probably damaging	Het
Slc36a2	A	T	11: 55,181,585	I67N	probably damaging	Het
Slc47a1	A	G	11: 61,373,422	F57S	probably damaging	Het
Spg11	T	A	2: 122,094,487	T756S	probably damaging	Het
Sptbn1	C	A	11: 30,121,591	R1447L	probably damaging	Het
Tcf7l2	A	G	19: 55,918,955	M340V	probably damaging	Het
Thap1	T	C	8: 26,162,705	V157A	probably benign	Het
Ubash3b	G	A	9: 41,023,557	Q354*	probably null	Het
Ubtd1	G	A	19: 42,032,021	W68*	probably null	Het
Wdr64	G	T	1: 175,793,081	R793L	probably damaging	Het
Zbtb24	C	T	10: 41,451,436	T106I	probably benign	Het
Zbtb26	T	C	2: 37,436,325	N233S	possibly damaging	Het
Zcchc24	A	T	14: 25,757,161	N99K	possibly damaging	Het

Other mutations in Kif12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01306:Kif12	APN	4	63165884	missense	probably damaging	0.99
IGL01377:Kif12	APN	4	63170725	missense	probably damaging	1.00
IGL02232:Kif12	APN	4	63166495	missense	probably benign	0.00
IGL02671:Kif12	APN	4	63170457	missense	probably benign	0.05
IGL02719:Kif12	APN	4	63167796	missense	probably benign
IGL03056:Kif12	APN	4	63166956	missense	probably null	0.00
ANU05:Kif12	UTSW	4	63171423	small insertion	probably benign
ANU23:Kif12	UTSW	4	63165884	missense	probably damaging	0.99
ANU74:Kif12	UTSW	4	63171423	small insertion	probably benign
ANU74:Kif12	UTSW	4	63171426	frame shift	probably null
IGL02984:Kif12	UTSW	4	63171423	small insertion	probably benign
R0401:Kif12	UTSW	4	63169525	splice site	probably benign
R1589:Kif12	UTSW	4	63166500	missense	probably benign	0.00
R2178:Kif12	UTSW	4	63166959	missense	probably benign	0.00
R2263:Kif12	UTSW	4	63169521	missense	probably benign	0.00
R2372:Kif12	UTSW	4	63168559	missense	possibly damaging	0.64
R2404:Kif12	UTSW	4	63170553	missense	probably damaging	1.00
R3903:Kif12	UTSW	4	63167976	missense	possibly damaging	0.73
R4126:Kif12	UTSW	4	63166437	missense	probably benign	0.00
R4271:Kif12	UTSW	4	63170746	missense	probably benign	0.39
R4386:Kif12	UTSW	4	63171218	missense	probably damaging	1.00
R4750:Kif12	UTSW	4	63167783	missense	probably damaging	0.99
R4945:Kif12	UTSW	4	63168493	critical splice donor site	probably null
R5177:Kif12	UTSW	4	63167904	missense	probably benign	0.13
R5421:Kif12	UTSW	4	63171428	missense	probably benign	0.40
R5644:Kif12	UTSW	4	63165893	missense	possibly damaging	0.75
R5757:Kif12	UTSW	4	63170518	missense	probably damaging	1.00
R5772:Kif12	UTSW	4	63165941	missense	probably damaging	1.00
R5858:Kif12	UTSW	4	63166410	missense	probably benign	0.04
R5929:Kif12	UTSW	4	63168517	missense	probably damaging	0.96
R6648:Kif12	UTSW	4	63171317	critical splice donor site	probably null
R7007:Kif12	UTSW	4	63166480	missense	probably benign
R7108:Kif12	UTSW	4	63171205	missense	probably benign	0.15
R7171:Kif12	UTSW	4	63168694	missense	probably damaging	1.00
R7852:Kif12	UTSW	4	63167989	missense	probably benign	0.13
R8532:Kif12	UTSW	4	63169419	nonsense	probably null
RF011:Kif12	UTSW	4	63171427	small insertion	probably benign
RF031:Kif12	UTSW	4	63171425	small insertion	probably benign
RF036:Kif12	UTSW	4	63171427	small insertion	probably benign
RF039:Kif12	UTSW	4	63171425	small insertion	probably benign
RF041:Kif12	UTSW	4	63171425	small insertion	probably benign
T0975:Kif12	UTSW	4	63171423	small insertion	probably benign
Z1088:Kif12	UTSW	4	63171423	small insertion	probably benign
Z1176:Kif12	UTSW	4	63171423	small insertion	probably benign
Z1176:Kif12	UTSW	4	63171997	missense	possibly damaging	0.95
Z1177:Kif12	UTSW	4	63171423	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- GCATATCGCAGAGTGCTGAGAGTC -3'
(R):5'- CACATCTGTGCCTTCAGAGATGCC -3'

Sequencing Primer
(F):5'- AGTCTCAGGAAGGCACTGC -3'
(R):5'- TTCAGAGATGCCGGTCTGC -3'

Posted On

2013-11-07