Incidental Mutation 'R0927:Kif12'
ID80485
Institutional Source Beutler Lab
Gene Symbol Kif12
Ensembl Gene ENSMUSG00000028357
Gene Namekinesin family member 12
SynonymsN-9 kinesin
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location63165630-63172131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63168773 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 305 (R305G)
Ref Sequence ENSEMBL: ENSMUSP00000030042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030042] [ENSMUST00000124739] [ENSMUST00000156618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030042
AA Change: R305G

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030042
Gene: ENSMUSG00000028357
AA Change: R305G

DomainStartEndE-ValueType
KISc 23 368 4.46e-108 SMART
coiled coil region 376 464 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131760
Predicted Effect probably benign
Transcript: ENSMUST00000154234
Predicted Effect possibly damaging
Transcript: ENSMUST00000156618
AA Change: R305G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily of microtubule-associated molecular motors with functions related to the microtubule cytosekelton. Members of this superfamily play important roles in intracellular transport and cell division. A similar protein in mouse functions in the beta cell antioxidant signaling cascade, acting as a scaffold for the transcription factor specificity protein 1 (Sp1). Mice that lack this gene exhibit beta cell oxidative stress resulting in hypoinsulinemic glucose intolerance. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Kif12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Kif12 APN 4 63165884 missense probably damaging 0.99
IGL01377:Kif12 APN 4 63170725 missense probably damaging 1.00
IGL02232:Kif12 APN 4 63166495 missense probably benign 0.00
IGL02671:Kif12 APN 4 63170457 missense probably benign 0.05
IGL02719:Kif12 APN 4 63167796 missense probably benign
IGL03056:Kif12 APN 4 63166956 missense probably null 0.00
ANU05:Kif12 UTSW 4 63171423 small insertion probably benign
ANU23:Kif12 UTSW 4 63165884 missense probably damaging 0.99
ANU74:Kif12 UTSW 4 63171423 small insertion probably benign
ANU74:Kif12 UTSW 4 63171426 frame shift probably null
IGL02984:Kif12 UTSW 4 63171423 small insertion probably benign
R0401:Kif12 UTSW 4 63169525 splice site probably benign
R1589:Kif12 UTSW 4 63166500 missense probably benign 0.00
R2178:Kif12 UTSW 4 63166959 missense probably benign 0.00
R2263:Kif12 UTSW 4 63169521 missense probably benign 0.00
R2372:Kif12 UTSW 4 63168559 missense possibly damaging 0.64
R2404:Kif12 UTSW 4 63170553 missense probably damaging 1.00
R3903:Kif12 UTSW 4 63167976 missense possibly damaging 0.73
R4126:Kif12 UTSW 4 63166437 missense probably benign 0.00
R4271:Kif12 UTSW 4 63170746 missense probably benign 0.39
R4386:Kif12 UTSW 4 63171218 missense probably damaging 1.00
R4750:Kif12 UTSW 4 63167783 missense probably damaging 0.99
R4945:Kif12 UTSW 4 63168493 critical splice donor site probably null
R5177:Kif12 UTSW 4 63167904 missense probably benign 0.13
R5421:Kif12 UTSW 4 63171428 missense probably benign 0.40
R5644:Kif12 UTSW 4 63165893 missense possibly damaging 0.75
R5757:Kif12 UTSW 4 63170518 missense probably damaging 1.00
R5772:Kif12 UTSW 4 63165941 missense probably damaging 1.00
R5858:Kif12 UTSW 4 63166410 missense probably benign 0.04
R5929:Kif12 UTSW 4 63168517 missense probably damaging 0.96
R6648:Kif12 UTSW 4 63171317 critical splice donor site probably null
R7007:Kif12 UTSW 4 63166480 missense probably benign
R7108:Kif12 UTSW 4 63171205 missense probably benign 0.15
R7171:Kif12 UTSW 4 63168694 missense probably damaging 1.00
R7852:Kif12 UTSW 4 63167989 missense probably benign 0.13
R7935:Kif12 UTSW 4 63167989 missense probably benign 0.13
RF011:Kif12 UTSW 4 63171427 small insertion probably benign
RF031:Kif12 UTSW 4 63171425 small insertion probably benign
RF036:Kif12 UTSW 4 63171427 small insertion probably benign
RF039:Kif12 UTSW 4 63171425 small insertion probably benign
RF041:Kif12 UTSW 4 63171425 small insertion probably benign
T0975:Kif12 UTSW 4 63171423 small insertion probably benign
Z1088:Kif12 UTSW 4 63171423 small insertion probably benign
Z1176:Kif12 UTSW 4 63171423 small insertion probably benign
Z1176:Kif12 UTSW 4 63171997 missense possibly damaging 0.95
Z1177:Kif12 UTSW 4 63171423 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GCATATCGCAGAGTGCTGAGAGTC -3'
(R):5'- CACATCTGTGCCTTCAGAGATGCC -3'

Sequencing Primer
(F):5'- AGTCTCAGGAAGGCACTGC -3'
(R):5'- TTCAGAGATGCCGGTCTGC -3'
Posted On2013-11-07