Incidental Mutation 'R0927:Kcnj8'
ID80505
Institutional Source Beutler Lab
Gene Symbol Kcnj8
Ensembl Gene ENSMUSG00000030247
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 8
SynonymsKir6.1, sltr, gnite, slmbr
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location142564837-142571614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 142565901 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 327 (I327L)
Ref Sequence ENSEMBL: ENSMUSP00000145440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032374] [ENSMUST00000203945]
Predicted Effect probably benign
Transcript: ENSMUST00000032374
SMART Domains Protein: ENSMUSP00000032374
Gene: ENSMUSG00000030247

DomainStartEndE-ValueType
Pfam:IRK 37 371 2.3e-141 PFAM
low complexity region 378 404 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203945
AA Change: I327L

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145440
Gene: ENSMUSG00000030247
AA Change: I327L

DomainStartEndE-ValueType
Pfam:IRK 37 371 2.3e-141 PFAM
low complexity region 378 404 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. Defects in this gene may be a cause of J-wave syndromes and sudden infant death syndrome (SIDS). [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit sudden cardiac death due to dysregulation of the vascular tonus in the coronary arteries, and exhibit a phenotype resembling Prinzmetal (or variant) angina in humans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Kcnj8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kcnj8 APN 6 142570235 missense probably damaging 1.00
IGL02303:Kcnj8 APN 6 142570111 missense probably benign 0.01
IGL03026:Kcnj8 APN 6 142566473 critical splice acceptor site probably null
goodnight UTSW 6 large deletion
mayday UTSW 6 large deletion
slumber UTSW 6 large deletion
solitaire UTSW 6 large deletion
sos UTSW 6 142565927 missense probably damaging 1.00
R0278:Kcnj8 UTSW 6 142570348 missense probably benign 0.12
R1680:Kcnj8 UTSW 6 142570189 nonsense probably null
R1864:Kcnj8 UTSW 6 142570240 missense probably damaging 1.00
R1865:Kcnj8 UTSW 6 142570240 missense probably damaging 1.00
R2087:Kcnj8 UTSW 6 142565696 missense probably benign 0.02
R4900:Kcnj8 UTSW 6 142566495 missense probably damaging 1.00
R5863:Kcnj8 UTSW 6 142565688 missense probably benign 0.02
R6493:Kcnj8 UTSW 6 142566047 missense probably damaging 1.00
R6598:Kcnj8 UTSW 6 142570233 missense probably damaging 1.00
R7068:Kcnj8 UTSW 6 142566239 missense probably damaging 1.00
R7587:Kcnj8 UTSW 6 142566339 missense probably damaging 1.00
R7698:Kcnj8 UTSW 6 142565753 missense probably damaging 1.00
R7908:Kcnj8 UTSW 6 142566029 missense probably benign 0.44
R7989:Kcnj8 UTSW 6 142566029 missense probably benign 0.44
X0018:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0020:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0026:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0027:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0061:Kcnj8 UTSW 6 142570120 missense probably damaging 1.00
X0065:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTGATGGACACTGGTTTCCTTCTGG -3'
(R):5'- ACGTGATTGACAAGCGTAGCCC -3'

Sequencing Primer
(F):5'- TCTGGAGTCATGAACTGCAC -3'
(R):5'- AAGCGTAGCCCCCTGTATG -3'
Posted On2013-11-07