Incidental Mutation 'R0927:Adam12'
ID 80507
Institutional Source Beutler Lab
Gene Symbol Adam12
Ensembl Gene ENSMUSG00000054555
Gene Name a disintegrin and metallopeptidase domain 12 (meltrin alpha)
Synonyms Mltna, ADAM12
MMRRC Submission 039074-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.443) question?
Stock # R0927 (G1)
Quality Score 159
Status Not validated
Chromosome 7
Chromosomal Location 133883199-134232146 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 133998230 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 85 (H85L)
Ref Sequence ENSEMBL: ENSMUSP00000120094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067680] [ENSMUST00000127524] [ENSMUST00000134504]
AlphaFold Q61824
Predicted Effect probably damaging
Transcript: ENSMUST00000067680
AA Change: H116L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065213
Gene: ENSMUSG00000054555
AA Change: H116L

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 165 1.1e-27 PFAM
Pfam:Reprolysin_5 210 392 2.1e-24 PFAM
Pfam:Reprolysin_4 210 408 3.8e-16 PFAM
Pfam:Reprolysin 212 414 1.4e-74 PFAM
Pfam:Reprolysin_2 232 404 6e-18 PFAM
Pfam:Reprolysin_3 236 359 1.3e-16 PFAM
DISIN 431 506 4.29e-42 SMART
ACR 507 650 1.75e-67 SMART
transmembrane domain 705 727 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127524
AA Change: H85L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120094
Gene: ENSMUSG00000054555
AA Change: H85L

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 6 135 4.3e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134504
AA Change: H85L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123161
Gene: ENSMUSG00000054555
AA Change: H85L

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 6 135 6.1e-36 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein that localizes to the cell surface. About a third of the mice lacking the encoded protein die before weaning. Overexpression of the encoded protein in a mouse model of Duchenne muscular dystrophy alleviates the muscle pathology by preventing cell necrosis and inflammation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mice display partial postnatal lethality, decreased brown fat, and impaired formation of neck and interscapular muscles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Adam12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Adam12 APN 7 133909881 missense possibly damaging 0.51
IGL01403:Adam12 APN 7 133919610 missense probably benign 0.00
IGL01482:Adam12 APN 7 133967848 missense probably damaging 1.00
IGL01922:Adam12 APN 7 133937472 nonsense probably null
IGL02397:Adam12 APN 7 133909819 splice site probably benign
IGL03401:Adam12 APN 7 133916463 missense probably damaging 1.00
R0122:Adam12 UTSW 7 134012348 missense probably benign 0.45
R0200:Adam12 UTSW 7 133974416 splice site probably null
R0463:Adam12 UTSW 7 133974416 splice site probably null
R1258:Adam12 UTSW 7 133937447 missense probably damaging 1.00
R1440:Adam12 UTSW 7 133931814 missense probably benign 0.03
R1483:Adam12 UTSW 7 133930025 missense probably benign 0.41
R1692:Adam12 UTSW 7 133887944 makesense probably null
R1797:Adam12 UTSW 7 133967861 missense probably benign 0.03
R2134:Adam12 UTSW 7 134012288 nonsense probably null
R2230:Adam12 UTSW 7 133919618 missense probably damaging 1.00
R2350:Adam12 UTSW 7 133919524 missense probably damaging 1.00
R2944:Adam12 UTSW 7 133975507 missense probably null 0.02
R3688:Adam12 UTSW 7 133964796 nonsense probably null
R3747:Adam12 UTSW 7 134172865 missense probably damaging 0.96
R3749:Adam12 UTSW 7 134172865 missense probably damaging 0.96
R3750:Adam12 UTSW 7 134172865 missense probably damaging 0.96
R4028:Adam12 UTSW 7 133929996 missense probably damaging 1.00
R4130:Adam12 UTSW 7 133912924 missense probably damaging 1.00
R4131:Adam12 UTSW 7 133912924 missense probably damaging 1.00
R4346:Adam12 UTSW 7 133981535 missense possibly damaging 0.82
R4701:Adam12 UTSW 7 133916462 missense possibly damaging 0.64
R4887:Adam12 UTSW 7 134172821 missense possibly damaging 0.74
R5355:Adam12 UTSW 7 133887942 makesense probably null
R5468:Adam12 UTSW 7 133975473 missense probably damaging 1.00
R5486:Adam12 UTSW 7 133907672 missense possibly damaging 0.75
R5990:Adam12 UTSW 7 133931736 missense probably damaging 1.00
R6504:Adam12 UTSW 7 133929984 missense probably damaging 1.00
R6783:Adam12 UTSW 7 133974397 missense probably damaging 1.00
R7117:Adam12 UTSW 7 133916462 missense probably benign 0.00
R7263:Adam12 UTSW 7 133919511 missense possibly damaging 0.68
R7749:Adam12 UTSW 7 134224813 missense unknown
R7820:Adam12 UTSW 7 133998188 missense probably benign 0.00
R7880:Adam12 UTSW 7 133909962 missense possibly damaging 0.94
R7891:Adam12 UTSW 7 133998232 missense probably benign 0.00
R8114:Adam12 UTSW 7 133967888 missense probably damaging 1.00
R8160:Adam12 UTSW 7 133968041 splice site probably null
R8683:Adam12 UTSW 7 133890200 missense possibly damaging 0.49
R9236:Adam12 UTSW 7 134012293 missense probably benign 0.03
R9277:Adam12 UTSW 7 133919832 missense probably benign 0.00
R9480:Adam12 UTSW 7 134134741 missense probably damaging 0.98
R9515:Adam12 UTSW 7 133907644 missense probably benign 0.03
R9599:Adam12 UTSW 7 133964725 missense probably damaging 0.99
X0057:Adam12 UTSW 7 134012315 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGAGGAACACTTGTACTGTCCAC -3'
(R):5'- GGAGGCTGATCAAGCATGTCCAAAC -3'

Sequencing Primer
(F):5'- ACACTTGTACTGTCCACAGTGTC -3'
(R):5'- GTCTGATACTCTAACCATAGGCTTGG -3'
Posted On 2013-11-07