Incidental Mutation 'R0927:Adam34'
ID80513
Institutional Source Beutler Lab
Gene Symbol Adam34
Ensembl Gene ENSMUSG00000079058
Gene Namea disintegrin and metallopeptidase domain 34
Synonymstestase 4
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location43650309-43710049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43651584 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 341 (H341Q)
Ref Sequence ENSEMBL: ENSMUSP00000148332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110411] [ENSMUST00000212185]
Predicted Effect probably damaging
Transcript: ENSMUST00000110411
AA Change: H341Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106041
Gene: ENSMUSG00000079058
AA Change: H341Q

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 159 5.9e-20 PFAM
Pfam:Reprolysin_5 205 377 1.6e-16 PFAM
Pfam:Reprolysin_4 205 393 3e-12 PFAM
Pfam:Reprolysin 207 397 9.4e-49 PFAM
Pfam:Reprolysin_2 224 389 1e-14 PFAM
Pfam:Reprolysin_3 231 352 2.7e-14 PFAM
DISIN 416 491 3.38e-40 SMART
ACR 492 628 9.18e-62 SMART
transmembrane domain 685 707 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212185
AA Change: H341Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Adam34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Adam34 APN 8 43652190 missense possibly damaging 0.91
IGL01296:Adam34 APN 8 43651141 missense possibly damaging 0.90
IGL01369:Adam34 APN 8 43651057 missense probably benign 0.00
IGL01933:Adam34 APN 8 43651532 missense probably damaging 1.00
IGL01938:Adam34 APN 8 43651016 missense probably damaging 1.00
IGL02112:Adam34 APN 8 43651138 missense possibly damaging 0.46
IGL02182:Adam34 APN 8 43651753 missense probably benign
IGL02306:Adam34 APN 8 43650485 missense probably benign 0.44
IGL02661:Adam34 APN 8 43651535 missense probably damaging 1.00
IGL02888:Adam34 APN 8 43651573 missense probably damaging 1.00
IGL02979:Adam34 APN 8 43651371 missense probably damaging 1.00
IGL03073:Adam34 APN 8 43650903 missense probably damaging 0.99
PIT4453001:Adam34 UTSW 8 43651312 missense probably damaging 1.00
R0060:Adam34 UTSW 8 43675883 intron probably benign
R0317:Adam34 UTSW 8 43652251 missense probably benign 0.14
R0322:Adam34 UTSW 8 43651921 missense probably benign 0.00
R0427:Adam34 UTSW 8 43652456 missense probably benign 0.15
R0593:Adam34 UTSW 8 43651687 missense possibly damaging 0.87
R0837:Adam34 UTSW 8 43651500 missense probably benign 0.00
R1634:Adam34 UTSW 8 43652090 missense possibly damaging 0.81
R1653:Adam34 UTSW 8 43650645 nonsense probably null
R1826:Adam34 UTSW 8 43651342 missense probably damaging 1.00
R1873:Adam34 UTSW 8 43651806 missense probably benign 0.02
R1943:Adam34 UTSW 8 43650827 missense possibly damaging 0.48
R1943:Adam34 UTSW 8 43651815 missense probably damaging 1.00
R2147:Adam34 UTSW 8 43652501 missense probably benign 0.01
R2150:Adam34 UTSW 8 43652501 missense probably benign 0.01
R2206:Adam34 UTSW 8 43652237 missense probably benign 0.02
R2207:Adam34 UTSW 8 43652237 missense probably benign 0.02
R2268:Adam34 UTSW 8 43650610 missense probably benign 0.00
R2349:Adam34 UTSW 8 43652378 missense probably damaging 0.99
R3983:Adam34 UTSW 8 43650769 missense probably benign
R4158:Adam34 UTSW 8 43650817 missense probably damaging 1.00
R4179:Adam34 UTSW 8 43651091 missense probably benign 0.18
R5219:Adam34 UTSW 8 43651424 missense probably benign
R5398:Adam34 UTSW 8 43651241 missense probably damaging 1.00
R5611:Adam34 UTSW 8 43651712 missense probably benign 0.43
R5928:Adam34 UTSW 8 43652030 missense probably benign 0.08
R6115:Adam34 UTSW 8 43652061 missense probably benign
R6319:Adam34 UTSW 8 43651915 missense probably benign 0.01
R6384:Adam34 UTSW 8 43650799 missense probably benign 0.00
R6706:Adam34 UTSW 8 43651442 nonsense probably null
R6992:Adam34 UTSW 8 43652605 start codon destroyed probably null 1.00
R7032:Adam34 UTSW 8 43652266 missense probably damaging 1.00
R7151:Adam34 UTSW 8 43651462 missense probably benign 0.19
R7187:Adam34 UTSW 8 43652528 missense probably benign 0.02
R7223:Adam34 UTSW 8 43652004 missense probably benign 0.02
R7487:Adam34 UTSW 8 43651154 missense probably damaging 1.00
R7726:Adam34 UTSW 8 43651171 missense probably damaging 0.99
R7789:Adam34 UTSW 8 43652451 missense probably benign 0.00
R7810:Adam34 UTSW 8 43652008 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGCCACACATGGTTGGCATCAGG -3'
(R):5'- TGAGAATTGGTGGACGCATCACAGG -3'

Sequencing Primer
(F):5'- ACATGGTTGGCATCAGGTTTATTG -3'
(R):5'- GGACGCATCACAGGTTTATTG -3'
Posted On2013-11-07