Incidental Mutation 'R0927:Glra3'
ID80515
Institutional Source Beutler Lab
Gene Symbol Glra3
Ensembl Gene ENSMUSG00000038257
Gene Nameglycine receptor, alpha 3 subunit
Synonyms
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location55940460-56130070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56125204 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 432 (E432G)
Ref Sequence ENSEMBL: ENSMUSP00000000275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000275
AA Change: E432G

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000000275
Gene: ENSMUSG00000038257
AA Change: E432G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Neur_chan_LBD 59 269 3.7e-55 PFAM
Pfam:Neur_chan_memb 276 434 1.4e-35 PFAM
PDB:2M6I|E 437 474 1e-12 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ligand-gated ion channel protein family. The encoded protein is a member of the glycine receptor subfamily. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice are fertile and display decreased inflammatory pain sensitization without any gross abnormalities in the brain or spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Glra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Glra3 APN 8 55940977 splice site probably benign
IGL01301:Glra3 APN 8 55940962 missense probably benign 0.00
IGL01772:Glra3 APN 8 56089055 missense probably benign 0.22
IGL02280:Glra3 APN 8 55940971 missense possibly damaging 0.67
IGL02386:Glra3 APN 8 56089028 missense probably benign 0.12
IGL02508:Glra3 APN 8 56085144 missense probably benign 0.10
IGL03094:Glra3 APN 8 56125172 missense probably benign
ANU18:Glra3 UTSW 8 55940962 missense probably benign 0.00
R0532:Glra3 UTSW 8 56125076 missense probably benign
R0708:Glra3 UTSW 8 56125364 utr 3 prime probably benign
R0710:Glra3 UTSW 8 56125364 utr 3 prime probably benign
R1125:Glra3 UTSW 8 56039754 missense possibly damaging 0.69
R1138:Glra3 UTSW 8 56088976 splice site probably null
R1717:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1718:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1848:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1933:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1934:Glra3 UTSW 8 55940907 missense probably benign 0.07
R2042:Glra3 UTSW 8 56062459 missense probably benign 0.36
R2571:Glra3 UTSW 8 56110481 missense probably benign 0.41
R3123:Glra3 UTSW 8 56125209 missense possibly damaging 0.94
R3124:Glra3 UTSW 8 56125209 missense possibly damaging 0.94
R4585:Glra3 UTSW 8 56088993 missense probably damaging 1.00
R4593:Glra3 UTSW 8 55940881 missense probably damaging 1.00
R4981:Glra3 UTSW 8 55991235 missense possibly damaging 0.69
R5277:Glra3 UTSW 8 55991207 missense possibly damaging 0.79
R5356:Glra3 UTSW 8 55940901 missense probably benign 0.00
R6214:Glra3 UTSW 8 55991256 splice site probably null
R6941:Glra3 UTSW 8 55940926 missense probably benign 0.00
Z1176:Glra3 UTSW 8 56062500 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGAAATCCTGTATCGCTCGCCG -3'
(R):5'- TGTCAGGAATATGAAGCAGGACCCC -3'

Sequencing Primer
(F):5'- GCCGTTGTTTTTACTAAACACCTG -3'
(R):5'- CAGGGAATCTTTCTTCTGAATGC -3'
Posted On2013-11-07