Incidental Mutation 'R0927:Chtf8'
ID80517
Institutional Source Beutler Lab
Gene Symbol Chtf8
Ensembl Gene ENSMUSG00000046691
Gene NameCTF8, chromosome transmission fidelity factor 8
Synonyms
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106883863-106893601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106885518 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 263 (T263I)
Ref Sequence ENSEMBL: ENSMUSP00000129823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034385] [ENSMUST00000169312] [ENSMUST00000175940] [ENSMUST00000175987] [ENSMUST00000176090] [ENSMUST00000176144] [ENSMUST00000176437] [ENSMUST00000176515] [ENSMUST00000177068]
Predicted Effect probably benign
Transcript: ENSMUST00000034385
SMART Domains Protein: ENSMUSP00000034385
Gene: ENSMUSG00000031910

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 85 361 4e-22 PFAM
Pfam:Glycos_transf_2 183 300 4.5e-7 PFAM
Pfam:Glyco_transf_21 188 360 5.7e-8 PFAM
Pfam:Chitin_synth_2 198 451 7.7e-17 PFAM
Pfam:Glyco_trans_2_3 211 538 1.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169312
AA Change: T263I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129823
Gene: ENSMUSG00000046691
AA Change: T263I

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
internal_repeat_1 37 246 5.18e-7 PROSPERO
low complexity region 258 269 N/A INTRINSIC
low complexity region 322 339 N/A INTRINSIC
internal_repeat_1 344 520 5.18e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000175940
SMART Domains Protein: ENSMUSP00000135077
Gene: ENSMUSG00000046691

DomainStartEndE-ValueType
Pfam:Ctf8 3 113 4.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175987
SMART Domains Protein: ENSMUSP00000135596
Gene: ENSMUSG00000031910

DomainStartEndE-ValueType
transmembrane domain 11 33 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 85 251 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176090
SMART Domains Protein: ENSMUSP00000135221
Gene: ENSMUSG00000046691

DomainStartEndE-ValueType
Pfam:Ctf8 1 94 8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176144
SMART Domains Protein: ENSMUSP00000135303
Gene: ENSMUSG00000031910

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 85 361 4.5e-24 PFAM
Pfam:Glyco_transf_21 189 360 7e-8 PFAM
Pfam:Chitin_synth_2 197 457 3.2e-16 PFAM
Pfam:Glyco_trans_2_3 211 537 5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176437
SMART Domains Protein: ENSMUSP00000134860
Gene: ENSMUSG00000046691

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 109 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176515
SMART Domains Protein: ENSMUSP00000135688
Gene: ENSMUSG00000046691

DomainStartEndE-ValueType
Pfam:Ctf8 1 94 8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177068
SMART Domains Protein: ENSMUSP00000135029
Gene: ENSMUSG00000046691

DomainStartEndE-ValueType
Pfam:Ctf8 3 113 4.3e-26 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a short protein that forms part of the Ctf18 replication factor C (RFC) complex that occurs in both yeast and mammals. The heteroheptameric RFC complex plays a role in sister chromatid cohesion and may load the replication clamp PCNA (proliferating cell nuclear antigen) onto DNA during DNA replication and repair. This gene is ubiquitously expressed and has been shown to have reduced expression in renal and prostate tumors. Alternatively spliced transcript variants have been described. This gene has a pseudogene on chromosome X. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Chtf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03344:Chtf8 APN 8 106886272 missense probably damaging 1.00
R0751:Chtf8 UTSW 8 106886477 unclassified probably null
R2087:Chtf8 UTSW 8 106885936 nonsense probably null
R2359:Chtf8 UTSW 8 106885416 unclassified probably null
R3938:Chtf8 UTSW 8 106885905 missense probably benign 0.01
R4902:Chtf8 UTSW 8 106885792 missense probably damaging 1.00
R7105:Chtf8 UTSW 8 106885251 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAGGCCAATGTGCCAGAAGAC -3'
(R):5'- GTCCTGGACCAAGTCCAAATCTGAG -3'

Sequencing Primer
(F):5'- CTTGGAAAGACTCCAGCATTTAC -3'
(R):5'- GATCAAGCTTTTTAGGTACAAACCCG -3'
Posted On2013-11-07