Incidental Mutation 'R0927:Pus3'
ID80521
Institutional Source Beutler Lab
Gene Symbol Pus3
Ensembl Gene ENSMUSG00000032103
Gene Namepseudouridine synthase 3
Synonyms5730412F04Rik, 2610020J05Rik
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location35558595-35567401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35565031 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 72 (Y72C)
Ref Sequence ENSEMBL: ENSMUSP00000113382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034615] [ENSMUST00000115110] [ENSMUST00000121246]
Predicted Effect probably damaging
Transcript: ENSMUST00000034615
AA Change: Y72C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034615
Gene: ENSMUSG00000032103
AA Change: Y72C

DomainStartEndE-ValueType
coiled coil region 1 46 N/A INTRINSIC
Pfam:PseudoU_synth_1 68 190 6.8e-12 PFAM
Pfam:PseudoU_synth_1 213 331 4.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115110
SMART Domains Protein: ENSMUSP00000110762
Gene: ENSMUSG00000050555

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
Pfam:HYLS1_C 211 299 6.4e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121246
AA Change: Y72C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113382
Gene: ENSMUSG00000032103
AA Change: Y72C

DomainStartEndE-ValueType
coiled coil region 1 46 N/A INTRINSIC
Pfam:PseudoU_synth_1 68 190 3e-12 PFAM
Pfam:PseudoU_synth_1 213 316 1.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135768
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of tRNA pseudouridine from tRNA uridine at position 39 in the anticodon stem and loop of transfer RNAs. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Pus3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0018:Pus3 UTSW 9 35566624 missense probably benign
R0018:Pus3 UTSW 9 35566624 missense probably benign
R0376:Pus3 UTSW 9 35566422 missense possibly damaging 0.51
R3407:Pus3 UTSW 9 35566725 missense probably damaging 1.00
R3766:Pus3 UTSW 9 35566672 missense probably benign 0.01
R3832:Pus3 UTSW 9 35566578 missense probably benign 0.37
R3833:Pus3 UTSW 9 35566578 missense probably benign 0.37
R4655:Pus3 UTSW 9 35564932 missense probably benign 0.00
R5085:Pus3 UTSW 9 35565636 missense possibly damaging 0.93
R7238:Pus3 UTSW 9 35566669 missense probably benign
R7807:Pus3 UTSW 9 35566725 missense probably damaging 1.00
X0027:Pus3 UTSW 9 35566456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGACCTGCATGATTTCTTCCTG -3'
(R):5'- GCTCTGAGAAGCAAAGTATTGGCCC -3'

Sequencing Primer
(F):5'- TCATGGCTGAAAACACAGACAG -3'
(R):5'- AGCAAAGTATTGGCCCTTACCTG -3'
Posted On2013-11-07