Incidental Mutation 'R0927:Arpp19'
ID80525
Institutional Source Beutler Lab
Gene Symbol Arpp19
Ensembl Gene ENSMUSG00000007656
Gene NamecAMP-regulated phosphoprotein 19
Synonyms
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0927 (G1)
Quality Score161
Status Not validated
Chromosome9
Chromosomal Location75037614-75060313 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) G to A at 75037685 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007800] [ENSMUST00000164467] [ENSMUST00000167885] [ENSMUST00000168166] [ENSMUST00000168301] [ENSMUST00000169188] [ENSMUST00000169492] [ENSMUST00000170308]
Predicted Effect probably benign
Transcript: ENSMUST00000007800
SMART Domains Protein: ENSMUSP00000007800
Gene: ENSMUSG00000007656

DomainStartEndE-ValueType
Pfam:Endosulfine 7 104 4.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164467
SMART Domains Protein: ENSMUSP00000130730
Gene: ENSMUSG00000007656

DomainStartEndE-ValueType
Pfam:Endosulfine 7 104 4.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167885
SMART Domains Protein: ENSMUSP00000131597
Gene: ENSMUSG00000007656

DomainStartEndE-ValueType
Pfam:Endosulfine 3 88 5.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168166
SMART Domains Protein: ENSMUSP00000126618
Gene: ENSMUSG00000007656

DomainStartEndE-ValueType
Pfam:Endosulfine 7 104 4.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168301
Predicted Effect probably benign
Transcript: ENSMUST00000169188
SMART Domains Protein: ENSMUSP00000131922
Gene: ENSMUSG00000007656

DomainStartEndE-ValueType
Pfam:Endosulfine 10 65 7.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169448
Predicted Effect unknown
Transcript: ENSMUST00000169492
AA Change: A19T
SMART Domains Protein: ENSMUSP00000128921
Gene: ENSMUSG00000007656
AA Change: A19T

DomainStartEndE-ValueType
low complexity region 14 46 N/A INTRINSIC
Pfam:Endosulfine 54 142 1.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170308
SMART Domains Protein: ENSMUSP00000132350
Gene: ENSMUSG00000007656

DomainStartEndE-ValueType
Pfam:Endosulfine 7 104 4.5e-18 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 19-kD cAMP-regulated phosphoprotein plays a role in regulating mitosis by inhibiting protein phosphatase-2A (PP2A; see MIM 176915) (summary by Gharbi-Ayachi et al., 2010 [PubMed 21164014]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Arpp19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Arpp19 APN 9 75056776 missense probably damaging 0.98
R5636:Arpp19 UTSW 9 75037933 utr 5 prime probably benign
R6253:Arpp19 UTSW 9 75056734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAAGCAGAGGTACTGCCAAGC -3'
(R):5'- AGGGACAACGTCCTGAGCAAATC -3'

Sequencing Primer
(F):5'- TACTGCCAAGCAAGCAGAG -3'
(R):5'- AGCTGCCTGGTACACTTG -3'
Posted On2013-11-07