Incidental Mutation 'R0927:Edar'
ID80529
Institutional Source Beutler Lab
Gene Symbol Edar
Ensembl Gene ENSMUSG00000003227
Gene Nameectodysplasin-A receptor
Synonymsanhidrotic ectodysplasin receptor 1, ectodermal dysplasia receptor, ectodysplasin A1 isoform receptor (EDA-A1R), downless (dl), ED1R, ED3, ED5, EDA3
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location58600789-58675654 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 58629491 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000003312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003312]
Predicted Effect probably null
Transcript: ENSMUST00000003312
SMART Domains Protein: ENSMUSP00000003312
Gene: ENSMUSG00000003227

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:TNFR 31 71 2e-16 BLAST
SCOP:d1jmab1 31 91 2e-3 SMART
Blast:TNFR 74 113 5e-20 BLAST
low complexity region 149 169 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
SCOP:d1ngr__ 348 430 2e-4 SMART
low complexity region 439 448 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor family. The encoded transmembrane protein is a receptor for the soluble ligand ectodysplasin A, and can activate the nuclear factor-kappaB, JNK, and caspase-independent cell death pathways. It is required for the development of hair, teeth, and other ectodermal derivatives. Mutations in this gene result in autosomal dominant and recessive forms of hypohidrotic ectodermal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce abnormalities of the hair,teeth and some exocrine glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Edar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Edar APN 10 58628638 missense probably damaging 1.00
IGL01551:Edar APN 10 58606038 splice site probably benign
IGL02207:Edar APN 10 58610521 missense probably damaging 0.99
IGL02391:Edar APN 10 58628581 missense probably damaging 0.96
IGL03152:Edar APN 10 58609995 missense possibly damaging 0.88
achtung2 UTSW 10 58603163 missense probably damaging 1.00
two-tone UTSW 10 58603179 missense probably damaging 1.00
ANU23:Edar UTSW 10 58628638 missense probably damaging 1.00
R0113:Edar UTSW 10 58629449 missense probably damaging 1.00
R0413:Edar UTSW 10 58629440 missense probably benign 0.00
R1217:Edar UTSW 10 58628631 missense probably damaging 1.00
R1458:Edar UTSW 10 58607366 missense probably benign 0.27
R1651:Edar UTSW 10 58606053 missense possibly damaging 0.49
R3820:Edar UTSW 10 58621363 missense probably damaging 1.00
R3932:Edar UTSW 10 58610342 missense probably damaging 1.00
R4050:Edar UTSW 10 58609947 missense possibly damaging 0.74
R4911:Edar UTSW 10 58621324 missense probably benign 0.03
R4924:Edar UTSW 10 58629375 missense probably damaging 1.00
R4998:Edar UTSW 10 58606093 missense probably damaging 1.00
R5311:Edar UTSW 10 58607435 missense possibly damaging 0.68
R5314:Edar UTSW 10 58607360 missense probably benign 0.00
R5371:Edar UTSW 10 58607452 missense possibly damaging 0.64
R5566:Edar UTSW 10 58628641 missense possibly damaging 0.50
R5847:Edar UTSW 10 58603179 missense probably damaging 1.00
R7330:Edar UTSW 10 58610554 missense probably damaging 0.98
R7529:Edar UTSW 10 58612008 missense probably benign
R7812:Edar UTSW 10 58630104 missense probably benign
R7872:Edar UTSW 10 58610526 missense possibly damaging 0.88
R7955:Edar UTSW 10 58610526 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AATGTGCTGTGAGTCCACACCC -3'
(R):5'- AATGCCTGTCAGTGAAGAGTTAGCC -3'

Sequencing Primer
(F):5'- AGTCCACACCCCTGTGC -3'
(R):5'- AGACTGAGCGTCTGTAGCAC -3'
Posted On2013-11-07