Incidental Mutation 'R0927:Grin3b'
ID80531
Institutional Source Beutler Lab
Gene Symbol Grin3b
Ensembl Gene ENSMUSG00000035745
Gene Nameglutamate receptor, ionotropic, NMDA3B
SynonymsNR3B
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79970715-79977190 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79971228 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 110 (R110Q)
Ref Sequence ENSEMBL: ENSMUSP00000048576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045085] [ENSMUST00000045247]
Predicted Effect probably benign
Transcript: ENSMUST00000045085
AA Change: R110Q

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000048576
Gene: ENSMUSG00000035745
AA Change: R110Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 39 60 N/A INTRINSIC
low complexity region 217 230 N/A INTRINSIC
PBPe 458 810 1.01e-82 SMART
Lig_chan-Glu_bd 459 522 6.6e-20 SMART
transmembrane domain 826 848 N/A INTRINSIC
low complexity region 914 930 N/A INTRINSIC
coiled coil region 950 984 N/A INTRINSIC
low complexity region 989 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045247
SMART Domains Protein: ENSMUSP00000041049
Gene: ENSMUSG00000035754

DomainStartEndE-ValueType
Blast:WD40 27 66 3e-17 BLAST
WD40 70 107 1.48e1 SMART
WD40 110 149 1.24e-4 SMART
WD40 161 202 2.49e-1 SMART
WD40 205 243 2.05e1 SMART
WD40 258 297 2.32e-9 SMART
low complexity region 353 367 N/A INTRINSIC
Pfam:WD40_alt 383 429 4.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126383
Predicted Effect probably benign
Transcript: ENSMUST00000131816
SMART Domains Protein: ENSMUSP00000122984
Gene: ENSMUSG00000035745

DomainStartEndE-ValueType
Pfam:Lig_chan 1 368 2.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132080
Predicted Effect probably benign
Transcript: ENSMUST00000149148
SMART Domains Protein: ENSMUSP00000116887
Gene: ENSMUSG00000035745

DomainStartEndE-ValueType
PBPe 100 452 1.01e-82 SMART
Lig_chan-Glu_bd 101 164 6.6e-20 SMART
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220249
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of an N-methyl-D-aspartate (NMDA) receptor. The encoded protein is found primarily in motor neurons, where it forms a heterotetramer with GRIN1 to create an excitatory glycine receptor. Variations in this gene have been proposed to be linked to schizophrenia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele show a mild impairment in motor learning or coordination, reduced home cage activity, a highly increased social interaction with familiar cagemates in their home cage but moderately increased anxiety-like behavior and reduced social interaction in a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Grin3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02754:Grin3b APN 10 79972889 missense possibly damaging 0.50
IGL03352:Grin3b APN 10 79973781 missense probably damaging 0.99
R0485:Grin3b UTSW 10 79974056 missense possibly damaging 0.68
R1526:Grin3b UTSW 10 79974602 missense probably damaging 1.00
R1699:Grin3b UTSW 10 79975882 missense probably damaging 0.99
R1789:Grin3b UTSW 10 79973408 missense probably benign
R1916:Grin3b UTSW 10 79974598 missense probably damaging 1.00
R1991:Grin3b UTSW 10 79970912 missense probably benign
R1991:Grin3b UTSW 10 79974646 missense probably damaging 1.00
R4359:Grin3b UTSW 10 79972897 missense probably benign 0.00
R4817:Grin3b UTSW 10 79976898 missense probably benign 0.01
R4909:Grin3b UTSW 10 79977104 makesense probably null
R4942:Grin3b UTSW 10 79975722 missense probably damaging 0.99
R4981:Grin3b UTSW 10 79976357 intron probably benign
R5689:Grin3b UTSW 10 79974631 missense probably damaging 1.00
R5910:Grin3b UTSW 10 79973021 missense probably benign 0.00
R6132:Grin3b UTSW 10 79976440 missense probably damaging 1.00
R6242:Grin3b UTSW 10 79976179 missense probably damaging 1.00
R6262:Grin3b UTSW 10 79974369 missense probably benign 0.38
R6336:Grin3b UTSW 10 79976461 missense probably damaging 1.00
R6942:Grin3b UTSW 10 79976119 critical splice donor site probably null
R7201:Grin3b UTSW 10 79974078 missense possibly damaging 0.96
R7322:Grin3b UTSW 10 79975695 missense probably damaging 1.00
R7526:Grin3b UTSW 10 79973051 missense probably benign
R7707:Grin3b UTSW 10 79975901 missense possibly damaging 0.89
R8069:Grin3b UTSW 10 79977034 missense unknown
Predicted Primers PCR Primer
(F):5'- TCGCACAGCACAGTGGTAACTTC -3'
(R):5'- AGCGGAATACTGTTCTAGCCAAAGC -3'

Sequencing Primer
(F):5'- ACAGTGGTAACTTCCATCGG -3'
(R):5'- GCATGTTAAGGCATCTTGGGAG -3'
Posted On2013-11-07