Incidental Mutation 'R0927:Olfr734'
ID80553
Institutional Source Beutler Lab
Gene Symbol Olfr734
Ensembl Gene ENSMUSG00000045306
Gene Nameolfactory receptor 734
SynonymsMOR242-1, GA_x6K02T2PMLR-6013665-6012724
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50316506-50326761 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 50320729 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 35 (Y35*)
Ref Sequence ENSEMBL: ENSMUSP00000150732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050928] [ENSMUST00000217152]
Predicted Effect probably null
Transcript: ENSMUST00000050928
AA Change: Y35*
SMART Domains Protein: ENSMUSP00000057376
Gene: ENSMUSG00000045306
AA Change: Y35*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-39 PFAM
Pfam:7tm_1 41 302 4.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216732
Predicted Effect probably null
Transcript: ENSMUST00000217152
AA Change: Y35*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Olfr734
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr734 APN 14 50320275 missense probably damaging 0.96
IGL01285:Olfr734 APN 14 50320256 missense possibly damaging 0.88
IGL02106:Olfr734 APN 14 50320160 missense probably damaging 1.00
IGL02313:Olfr734 APN 14 50320016 missense probably damaging 0.99
IGL03125:Olfr734 APN 14 50320692 missense probably benign 0.01
R0276:Olfr734 UTSW 14 50320179 missense probably benign 0.23
R0547:Olfr734 UTSW 14 50320118 missense probably benign 0.06
R0567:Olfr734 UTSW 14 50320658 missense probably damaging 0.99
R1506:Olfr734 UTSW 14 50320484 missense probably benign 0.00
R4032:Olfr734 UTSW 14 50320310 missense possibly damaging 0.91
R5179:Olfr734 UTSW 14 50320536 nonsense probably null
R5401:Olfr734 UTSW 14 50320109 missense probably damaging 1.00
R6240:Olfr734 UTSW 14 50320586 missense probably benign 0.00
R7752:Olfr734 UTSW 14 50320116 missense probably damaging 1.00
R7901:Olfr734 UTSW 14 50320116 missense probably damaging 1.00
R7984:Olfr734 UTSW 14 50320116 missense probably damaging 1.00
R8034:Olfr734 UTSW 14 50320566 missense probably damaging 1.00
X0064:Olfr734 UTSW 14 50320054 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTCTACAAGCATCTTAGGCGCTG -3'
(R):5'- CAGGTGTGTGGCATAGTCTTGAAGTAA -3'

Sequencing Primer
(F):5'- AAGCATCTTAGGCGCTGTGATAG -3'
(R):5'- gagcactgagccatcttcc -3'
Posted On2013-11-07