Incidental Mutation 'R0927:Adcy5'
ID80561
Institutional Source Beutler Lab
Gene Symbol Adcy5
Ensembl Gene ENSMUSG00000022840
Gene Nameadenylate cyclase 5
SynonymsAC5
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location35154877-35305738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35156243 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 49 (S49T)
Ref Sequence ENSEMBL: ENSMUSP00000110563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114913]
Predicted Effect probably benign
Transcript: ENSMUST00000114913
AA Change: S49T

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: S49T

DomainStartEndE-ValueType
low complexity region 47 59 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 107 150 N/A INTRINSIC
low complexity region 158 175 N/A INTRINSIC
low complexity region 181 208 N/A INTRINSIC
low complexity region 243 258 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
CYCc 424 623 2.62e-69 SMART
Pfam:DUF1053 669 762 1.8e-30 PFAM
transmembrane domain 794 816 N/A INTRINSIC
transmembrane domain 837 856 N/A INTRINSIC
transmembrane domain 910 932 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 985 1004 N/A INTRINSIC
CYCc 1032 1240 2.98e-50 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Adcy5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Adcy5 APN 16 35253213 missense possibly damaging 0.49
IGL01583:Adcy5 APN 16 35283513 splice site probably benign
IGL01608:Adcy5 APN 16 35272165 missense probably damaging 1.00
IGL02097:Adcy5 APN 16 35272098 missense probably damaging 1.00
IGL02122:Adcy5 APN 16 35283612 splice site probably benign
IGL02532:Adcy5 APN 16 35272083 missense possibly damaging 0.79
IGL02814:Adcy5 APN 16 35303649 missense probably benign 0.08
IGL02877:Adcy5 APN 16 35298600 missense probably damaging 1.00
IGL03026:Adcy5 APN 16 35157042 missense probably benign 0.41
IGL03345:Adcy5 APN 16 35248814 missense probably benign 0.05
H8562:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
H8786:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
R0050:Adcy5 UTSW 16 35304303 utr 3 prime probably benign
R0091:Adcy5 UTSW 16 35270998 critical splice donor site probably null
R0112:Adcy5 UTSW 16 35156178 missense possibly damaging 0.85
R0398:Adcy5 UTSW 16 35269068 missense probably damaging 1.00
R0457:Adcy5 UTSW 16 35274545 missense probably benign 0.07
R0554:Adcy5 UTSW 16 35294017 missense probably benign 0.26
R0698:Adcy5 UTSW 16 35290082 missense possibly damaging 0.78
R0761:Adcy5 UTSW 16 35270825 splice site probably benign
R0865:Adcy5 UTSW 16 35274471 missense probably damaging 0.96
R0945:Adcy5 UTSW 16 35290111 missense probably benign
R1534:Adcy5 UTSW 16 35253259 missense possibly damaging 0.92
R1565:Adcy5 UTSW 16 35268957 missense probably damaging 1.00
R1721:Adcy5 UTSW 16 35298424 missense probably damaging 1.00
R1839:Adcy5 UTSW 16 35248940 missense probably damaging 1.00
R2047:Adcy5 UTSW 16 35290108 missense possibly damaging 0.78
R3052:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3053:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3827:Adcy5 UTSW 16 35290097 missense probably benign 0.03
R4398:Adcy5 UTSW 16 35268993 missense probably damaging 1.00
R4700:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R4965:Adcy5 UTSW 16 35278502 missense possibly damaging 0.82
R5229:Adcy5 UTSW 16 35269070 missense probably damaging 0.99
R5456:Adcy5 UTSW 16 35298522 missense probably damaging 1.00
R5586:Adcy5 UTSW 16 35157116 missense probably damaging 0.99
R5757:Adcy5 UTSW 16 35272081 missense probably damaging 1.00
R5959:Adcy5 UTSW 16 35298410 missense probably damaging 1.00
R6011:Adcy5 UTSW 16 35157228 missense probably benign 0.05
R6277:Adcy5 UTSW 16 35289526 missense probably benign 0.02
R6296:Adcy5 UTSW 16 35303710 missense probably damaging 1.00
R6379:Adcy5 UTSW 16 35293999 missense probably benign 0.13
R6431:Adcy5 UTSW 16 35279237 missense probably damaging 1.00
R6685:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R6728:Adcy5 UTSW 16 35157165 missense possibly damaging 0.88
R6755:Adcy5 UTSW 16 35303634 missense possibly damaging 0.95
R6887:Adcy5 UTSW 16 35298590 missense possibly damaging 0.74
R7029:Adcy5 UTSW 16 35299648 missense probably null 0.91
R7047:Adcy5 UTSW 16 35267215 missense probably damaging 1.00
R7050:Adcy5 UTSW 16 35303700 missense possibly damaging 0.88
R7102:Adcy5 UTSW 16 35299625 missense probably damaging 1.00
R7150:Adcy5 UTSW 16 35298534 missense probably damaging 1.00
R7242:Adcy5 UTSW 16 35156835 missense probably damaging 1.00
R7387:Adcy5 UTSW 16 35272090 missense probably damaging 1.00
V7732:Adcy5 UTSW 16 35283541 missense probably benign 0.00
X0022:Adcy5 UTSW 16 35299456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACGTGTGACCCTAGCCTGGT -3'
(R):5'- CGACGGGAACTTCTTAGAGCGGAAT -3'

Sequencing Primer
(F):5'- CTCCTTGGAGAcccccg -3'
(R):5'- ATCCTCGACGATGCCAGTC -3'
Posted On2013-11-07