Mutagenetix > Incidental Mutations

Incidental Mutation 'R0927:Adcy5'

80561

Institutional Source

Beutler Lab

Gene Symbol

Adcy5

Ensembl Gene

ENSMUSG00000022840

Gene Name

adenylate cyclase 5

Synonyms

AC5

MMRRC Submission

039074-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.187) question?

Stock #

R0927 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

35154877-35305738 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 35156243 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 49 (S49T)

Ref Sequence

ENSEMBL: ENSMUSP00000110563 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114913]

Predicted Effect

probably benign
Transcript: ENSMUST00000114913
AA Change: S49T

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: S49T

Domain	Start	End	E-Value	Type
low complexity region	47	59	N/A	INTRINSIC
low complexity region	75	89	N/A	INTRINSIC
low complexity region	107	150	N/A	INTRINSIC
low complexity region	158	175	N/A	INTRINSIC
low complexity region	181	208	N/A	INTRINSIC
low complexity region	243	258	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
low complexity region	305	320	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
CYCc	424	623	2.62e-69	SMART
Pfam:DUF1053	669	762	1.8e-30	PFAM
transmembrane domain	794	816	N/A	INTRINSIC
transmembrane domain	837	856	N/A	INTRINSIC
transmembrane domain	910	932	N/A	INTRINSIC
transmembrane domain	934	956	N/A	INTRINSIC
transmembrane domain	985	1004	N/A	INTRINSIC
CYCc	1032	1240	2.98e-50	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.0%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	T	C	5: 24,402,319	L363P	probably damaging	Het
Adam12	T	A	7: 133,998,230	H85L	probably damaging	Het
Adam34	A	T	8: 43,651,584	H341Q	probably damaging	Het
Adam7	A	G	14: 68,516,684	L322P	probably damaging	Het
Arfgap2	T	C	2: 91,273,805	S374P	probably benign	Het
Arpp19	G	A	9: 75,037,685		probably benign	Het
Baz1a	T	C	12: 54,894,988	K1478E	probably damaging	Het
Cdc27	G	T	11: 104,505,641	A812E	possibly damaging	Het
Chtf8	G	A	8: 106,885,518	T263I	probably damaging	Het
Clcn6	T	C	4: 148,029,392	N70D	probably benign	Het
Cntnap5c	A	T	17: 58,042,558	T289S	possibly damaging	Het
Dzip3	T	C	16: 48,975,477	N177S	probably damaging	Het
Edar	G	T	10: 58,629,491		probably null	Het
Enam	T	A	5: 88,494,060	N244K	possibly damaging	Het
Fbxw10	A	G	11: 62,876,944	K874E	probably damaging	Het
Glra3	A	G	8: 56,125,204	E432G	possibly damaging	Het
Gm13084	A	T	4: 143,812,808	D38E	probably benign	Het
Gm13088	T	A	4: 143,654,220	H411L	possibly damaging	Het
Gm5346	A	T	8: 43,625,123	M688K	probably benign	Het
Grin3b	G	A	10: 79,971,228	R110Q	probably benign	Het
Herc3	T	A	6: 58,868,763	V423D	possibly damaging	Het
Ifit2	A	T	19: 34,573,584	T175S	probably benign	Het
Kcnj8	T	G	6: 142,565,901	I327L	possibly damaging	Het
Kcns2	A	T	15: 34,839,096	I202F	probably benign	Het
Kif12	T	C	4: 63,168,773	R305G	possibly damaging	Het
Limch1	A	G	5: 66,997,233	D362G	probably damaging	Het
Lrba	T	C	3: 86,780,233	I2815T	probably damaging	Het
Lrrtm1	G	T	6: 77,244,860	M433I	probably damaging	Het
Myh7b	A	G	2: 155,620,120	D312G	probably damaging	Het
Nrxn1	A	T	17: 90,037,330	I382N	probably damaging	Het
Nudt6	C	T	3: 37,405,353	R161H	probably benign	Het
Olfr1490	T	A	19: 13,654,452	W8R	probably damaging	Het
Olfr734	A	T	14: 50,320,729	Y35*	probably null	Het
Olfr744	A	C	14: 50,618,587	M122L	possibly damaging	Het
Olfr857	C	T	9: 19,713,649	A274V	probably benign	Het
Pmf1	A	T	3: 88,396,062	V64D	probably damaging	Het
Pomgnt1	T	A	4: 116,151,851	V29D	probably damaging	Het
Prex1	C	T	2: 166,586,537	A925T	probably benign	Het
Pus3	A	G	9: 35,565,031	Y72C	probably damaging	Het
Rnf20	T	C	4: 49,642,176	S247P	probably damaging	Het
Rnf213	T	A	11: 119,414,570	D542E	probably benign	Het
Sidt1	T	C	16: 44,243,532	D786G	probably benign	Het
Sirt6	A	T	10: 81,622,641	D219E	probably damaging	Het
Slc36a2	A	T	11: 55,181,585	I67N	probably damaging	Het
Slc47a1	A	G	11: 61,373,422	F57S	probably damaging	Het
Spg11	T	A	2: 122,094,487	T756S	probably damaging	Het
Sptbn1	C	A	11: 30,121,591	R1447L	probably damaging	Het
Tcf7l2	A	G	19: 55,918,955	M340V	probably damaging	Het
Thap1	T	C	8: 26,162,705	V157A	probably benign	Het
Ubash3b	G	A	9: 41,023,557	Q354*	probably null	Het
Ubtd1	G	A	19: 42,032,021	W68*	probably null	Het
Wdr64	G	T	1: 175,793,081	R793L	probably damaging	Het
Zbtb24	C	T	10: 41,451,436	T106I	probably benign	Het
Zbtb26	T	C	2: 37,436,325	N233S	possibly damaging	Het
Zcchc24	A	T	14: 25,757,161	N99K	possibly damaging	Het

Other mutations in Adcy5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Adcy5	APN	16	35253213	missense	possibly damaging	0.49
IGL01583:Adcy5	APN	16	35283513	splice site	probably benign
IGL01608:Adcy5	APN	16	35272165	missense	probably damaging	1.00
IGL02097:Adcy5	APN	16	35272098	missense	probably damaging	1.00
IGL02122:Adcy5	APN	16	35283612	splice site	probably benign
IGL02532:Adcy5	APN	16	35272083	missense	possibly damaging	0.79
IGL02814:Adcy5	APN	16	35303649	missense	probably benign	0.08
IGL02877:Adcy5	APN	16	35298600	missense	probably damaging	1.00
IGL03026:Adcy5	APN	16	35157042	missense	probably benign	0.41
IGL03345:Adcy5	APN	16	35248814	missense	probably benign	0.05
H8562:Adcy5	UTSW	16	35267181	missense	probably damaging	1.00
H8786:Adcy5	UTSW	16	35267181	missense	probably damaging	1.00
R0050:Adcy5	UTSW	16	35304303	utr 3 prime	probably benign
R0091:Adcy5	UTSW	16	35270998	critical splice donor site	probably null
R0112:Adcy5	UTSW	16	35156178	missense	possibly damaging	0.85
R0398:Adcy5	UTSW	16	35269068	missense	probably damaging	1.00
R0457:Adcy5	UTSW	16	35274545	missense	probably benign	0.07
R0554:Adcy5	UTSW	16	35294017	missense	probably benign	0.26
R0698:Adcy5	UTSW	16	35290082	missense	possibly damaging	0.78
R0761:Adcy5	UTSW	16	35270825	splice site	probably benign
R0865:Adcy5	UTSW	16	35274471	missense	probably damaging	0.96
R0945:Adcy5	UTSW	16	35290111	missense	probably benign
R1534:Adcy5	UTSW	16	35253259	missense	possibly damaging	0.92
R1565:Adcy5	UTSW	16	35268957	missense	probably damaging	1.00
R1721:Adcy5	UTSW	16	35298424	missense	probably damaging	1.00
R1839:Adcy5	UTSW	16	35248940	missense	probably damaging	1.00
R2047:Adcy5	UTSW	16	35290108	missense	possibly damaging	0.78
R3052:Adcy5	UTSW	16	35303716	missense	probably damaging	1.00
R3053:Adcy5	UTSW	16	35303716	missense	probably damaging	1.00
R3827:Adcy5	UTSW	16	35290097	missense	probably benign	0.03
R4398:Adcy5	UTSW	16	35268993	missense	probably damaging	1.00
R4700:Adcy5	UTSW	16	35279216	missense	possibly damaging	0.49
R4965:Adcy5	UTSW	16	35278502	missense	possibly damaging	0.82
R5229:Adcy5	UTSW	16	35269070	missense	probably damaging	0.99
R5456:Adcy5	UTSW	16	35298522	missense	probably damaging	1.00
R5586:Adcy5	UTSW	16	35157116	missense	probably damaging	0.99
R5757:Adcy5	UTSW	16	35272081	missense	probably damaging	1.00
R5959:Adcy5	UTSW	16	35298410	missense	probably damaging	1.00
R6011:Adcy5	UTSW	16	35157228	missense	probably benign	0.05
R6277:Adcy5	UTSW	16	35289526	missense	probably benign	0.02
R6296:Adcy5	UTSW	16	35303710	missense	probably damaging	1.00
R6379:Adcy5	UTSW	16	35293999	missense	probably benign	0.13
R6431:Adcy5	UTSW	16	35279237	missense	probably damaging	1.00
R6685:Adcy5	UTSW	16	35279216	missense	possibly damaging	0.49
R6728:Adcy5	UTSW	16	35157165	missense	possibly damaging	0.88
R6755:Adcy5	UTSW	16	35303634	missense	possibly damaging	0.95
R6887:Adcy5	UTSW	16	35298590	missense	possibly damaging	0.74
R7029:Adcy5	UTSW	16	35299648	missense	probably null	0.91
R7047:Adcy5	UTSW	16	35267215	missense	probably damaging	1.00
R7050:Adcy5	UTSW	16	35303700	missense	possibly damaging	0.88
R7102:Adcy5	UTSW	16	35299625	missense	probably damaging	1.00
R7150:Adcy5	UTSW	16	35298534	missense	probably damaging	1.00
R7242:Adcy5	UTSW	16	35156835	missense	probably damaging	1.00
R7387:Adcy5	UTSW	16	35272090	missense	probably damaging	1.00
R7654:Adcy5	UTSW	16	35270947	missense	probably damaging	1.00
R7718:Adcy5	UTSW	16	35280415	missense	probably benign	0.42
R7834:Adcy5	UTSW	16	35157200	missense	probably benign	0.03
R7917:Adcy5	UTSW	16	35157200	missense	probably benign	0.03
V7732:Adcy5	UTSW	16	35283541	missense	probably benign	0.00
X0022:Adcy5	UTSW	16	35299456	missense	probably damaging	0.99
Z1176:Adcy5	UTSW	16	35156321	missense	unknown
Z1176:Adcy5	UTSW	16	35290185	missense	probably benign	0.03
Z1176:Adcy5	UTSW	16	35291544	missense	not run
Z1177:Adcy5	UTSW	16	35291544	missense	not run

Predicted Primers

PCR Primer
(F):5'- ACGTGTGACCCTAGCCTGGT -3'
(R):5'- CGACGGGAACTTCTTAGAGCGGAAT -3'

Sequencing Primer
(F):5'- CTCCTTGGAGAcccccg -3'
(R):5'- ATCCTCGACGATGCCAGTC -3'

Posted On

2013-11-07