Incidental Mutation 'R0927:Dzip3'
ID80565
Institutional Source Beutler Lab
Gene Symbol Dzip3
Ensembl Gene ENSMUSG00000064061
Gene NameDAZ interacting protein 3, zinc finger
Synonyms2A-HUB, 6430549P11Rik, 2310047C04Rik
MMRRC Submission 039074-MU
Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location48924232-48994165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48975477 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 177 (N177S)
Ref Sequence ENSEMBL: ENSMUSP00000113344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]
Predicted Effect probably damaging
Transcript: ENSMUST00000114516
AA Change: N177S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061
AA Change: N177S

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121869
AA Change: N177S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: N177S

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Tcf7l2 A G 19: 55,918,955 M340V probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Dzip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Dzip3 APN 16 48928415 missense probably damaging 1.00
IGL00931:Dzip3 APN 16 48935497 critical splice donor site probably null
IGL01109:Dzip3 APN 16 48929674 missense probably benign 0.27
IGL01121:Dzip3 APN 16 48944881 missense probably benign 0.10
IGL01328:Dzip3 APN 16 48972258 missense probably damaging 1.00
IGL01729:Dzip3 APN 16 48928363 missense possibly damaging 0.78
IGL02044:Dzip3 APN 16 48948427 missense possibly damaging 0.90
IGL02051:Dzip3 APN 16 48972254 missense probably benign 0.01
IGL02115:Dzip3 APN 16 48948485 missense probably benign 0.00
IGL02125:Dzip3 APN 16 48927596 missense probably damaging 1.00
IGL02136:Dzip3 APN 16 48927582 missense possibly damaging 0.94
IGL02244:Dzip3 APN 16 48980988 missense probably benign 0.01
IGL02253:Dzip3 APN 16 48944924 missense probably benign 0.34
IGL02412:Dzip3 APN 16 48958457 missense probably benign 0.00
IGL02452:Dzip3 APN 16 48938537 splice site probably benign
IGL02481:Dzip3 APN 16 48975551 splice site probably benign
IGL02499:Dzip3 APN 16 48933850 missense probably damaging 1.00
IGL02511:Dzip3 APN 16 48936980 missense possibly damaging 0.75
IGL02519:Dzip3 APN 16 48928396 missense probably damaging 1.00
IGL02610:Dzip3 APN 16 48951653 missense probably damaging 1.00
IGL03129:Dzip3 APN 16 48942083 missense possibly damaging 0.51
IGL03342:Dzip3 APN 16 48929623 missense probably damaging 0.98
IGL03493:Dzip3 APN 16 48951696 missense probably benign 0.32
dazwick UTSW 16 48958465 missense possibly damaging 0.90
1mM(1):Dzip3 UTSW 16 48951557 missense probably damaging 1.00
PIT4651001:Dzip3 UTSW 16 48944878 missense probably benign
R0313:Dzip3 UTSW 16 48937061 missense probably damaging 0.99
R0483:Dzip3 UTSW 16 48947713 missense possibly damaging 0.94
R0504:Dzip3 UTSW 16 48959643 splice site probably benign
R0744:Dzip3 UTSW 16 48959675 missense probably damaging 1.00
R0800:Dzip3 UTSW 16 48953808 splice site probably benign
R0931:Dzip3 UTSW 16 48951558 missense probably damaging 1.00
R1170:Dzip3 UTSW 16 48961208 missense probably damaging 1.00
R1203:Dzip3 UTSW 16 48951817 missense probably damaging 1.00
R1205:Dzip3 UTSW 16 48951681 missense probably damaging 1.00
R1442:Dzip3 UTSW 16 48945622 missense probably benign 0.19
R1526:Dzip3 UTSW 16 48937006 missense probably damaging 1.00
R1560:Dzip3 UTSW 16 48951540 splice site probably null
R1585:Dzip3 UTSW 16 48977878 splice site probably benign
R1682:Dzip3 UTSW 16 48958417 critical splice donor site probably null
R1957:Dzip3 UTSW 16 48927593 missense probably damaging 1.00
R2472:Dzip3 UTSW 16 48953787 missense possibly damaging 0.85
R2571:Dzip3 UTSW 16 48972218 splice site probably null
R3040:Dzip3 UTSW 16 48928324 missense probably damaging 1.00
R3081:Dzip3 UTSW 16 48927558 missense probably damaging 1.00
R3615:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3616:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3786:Dzip3 UTSW 16 48975543 missense probably benign 0.08
R3851:Dzip3 UTSW 16 48950013 missense possibly damaging 0.94
R4097:Dzip3 UTSW 16 48958489 nonsense probably null
R4371:Dzip3 UTSW 16 48943455 critical splice donor site probably null
R4612:Dzip3 UTSW 16 48952040 nonsense probably null
R4671:Dzip3 UTSW 16 48979590 nonsense probably null
R4695:Dzip3 UTSW 16 48951561 missense probably damaging 1.00
R4696:Dzip3 UTSW 16 48925969 unclassified probably benign
R4769:Dzip3 UTSW 16 48938474 missense probably damaging 0.97
R5063:Dzip3 UTSW 16 48953754 nonsense probably null
R5321:Dzip3 UTSW 16 48957675 missense possibly damaging 0.95
R5764:Dzip3 UTSW 16 48927361 intron probably benign
R6020:Dzip3 UTSW 16 48951842 missense probably damaging 1.00
R6218:Dzip3 UTSW 16 48958465 missense possibly damaging 0.90
R6300:Dzip3 UTSW 16 48951807 missense probably damaging 1.00
R6365:Dzip3 UTSW 16 48931273 missense probably damaging 0.96
R6778:Dzip3 UTSW 16 48982083 missense probably benign 0.00
R6915:Dzip3 UTSW 16 48942125 missense possibly damaging 0.72
R7047:Dzip3 UTSW 16 48982126 missense probably benign 0.04
R7059:Dzip3 UTSW 16 48980942 missense probably benign 0.34
R7095:Dzip3 UTSW 16 48927790 missense probably benign
R7227:Dzip3 UTSW 16 48951569 missense probably damaging 0.99
R7319:Dzip3 UTSW 16 48927540 critical splice donor site probably null
R7436:Dzip3 UTSW 16 48951989 missense probably damaging 1.00
R7469:Dzip3 UTSW 16 48944879 missense probably benign
R7526:Dzip3 UTSW 16 48975474 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAACACTCCCGGACCACAAATGTTA -3'
(R):5'- CCCTAAGAAGAAACTATACCTATGGCTAAGGA -3'

Sequencing Primer
(F):5'- GGACCACAAATGTTATGATCAATTAC -3'
(R):5'- CTATACCTATGGCTAAGGAGTCAC -3'
Posted On2013-11-07