Incidental Mutation 'R0881:C9'
ID80570
Institutional Source Beutler Lab
Gene Symbol C9
Ensembl Gene ENSMUSG00000022149
Gene Namecomplement component 9
Synonyms
MMRRC Submission 039048-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0881 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location6445327-6498751 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 6458868 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000022749]
Predicted Effect probably benign
Transcript: ENSMUST00000022749
SMART Domains Protein: ENSMUSP00000022749
Gene: ENSMUSG00000022149

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
TSP1 56 106 1.8e-6 SMART
LDLa 111 147 2.7e-12 SMART
MACPF 304 519 2.9e-52 SMART
Blast:EGF 525 556 4e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128097
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 93.0%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the final component of the complement system. It participates in the formation of the Membrane Attack Complex (MAC). The MAC assembles on bacterial membranes to form a pore, permitting disruption of bacterial membrane organization. Mutations in this gene cause component C9 deficiency. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abcc9 T A 6: 142,646,303 I732F probably damaging Het
Adam10 T C 9: 70,746,237 S248P probably damaging Het
Adam18 A T 8: 24,672,143 probably benign Het
Angel2 G A 1: 190,937,464 E114K probably damaging Het
Arhgap29 A G 3: 122,014,679 T1169A probably damaging Het
Atp13a2 T A 4: 141,003,931 M759K probably damaging Het
Atxn2l A G 7: 126,496,596 S450P probably damaging Het
B3glct T A 5: 149,739,569 V264E probably damaging Het
Bbx A G 16: 50,220,600 probably benign Het
Bmp3 A G 5: 98,872,602 N295D possibly damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cdan1 A T 2: 120,720,985 V1039E probably damaging Het
Dennd4a T C 9: 64,851,383 probably null Het
Ext1 A G 15: 53,344,483 L294P probably benign Het
Fsip2 C A 2: 82,986,273 H4117N possibly damaging Het
Itga8 C T 2: 12,262,192 probably null Het
Itln1 G T 1: 171,533,381 H48N probably benign Het
Kcna5 T A 6: 126,534,994 H57L probably benign Het
Klhdc4 A T 8: 121,799,487 Y304* probably null Het
Klhl25 A G 7: 75,866,279 Y6C probably damaging Het
Lars C T 18: 42,214,786 V991M probably benign Het
Med20 T C 17: 47,611,680 M1T probably null Het
Mslnl A T 17: 25,742,965 H138L possibly damaging Het
Mycbp2 T C 14: 103,220,013 I1583V probably benign Het
Nipbl A C 15: 8,307,612 V2093G probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr340 T G 2: 36,453,440 L285R probably damaging Het
Olfr557 T A 7: 102,699,084 V282D possibly damaging Het
Olfr943 A G 9: 39,184,688 K170R probably benign Het
Opalin T C 19: 41,063,981 probably null Het
Pgm1 A T 5: 64,093,008 T9S unknown Het
Piwil2 A C 14: 70,408,927 S387A probably benign Het
Polr1c T C 17: 46,244,613 T240A possibly damaging Het
Polr3c A G 3: 96,723,847 M118T probably damaging Het
Pth1r C T 9: 110,731,573 C42Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rictor A T 15: 6,791,670 M1492L probably benign Het
Rrbp1 T A 2: 143,953,253 Y1277F probably benign Het
Scgb3a2 T G 18: 43,764,484 probably benign Het
Skint1 G A 4: 112,028,857 S327N probably benign Het
Steap4 A T 5: 7,980,388 S415C probably benign Het
Tex48 A G 4: 63,611,991 probably benign Het
Tox2 T A 2: 163,321,445 S502T probably benign Het
Usp47 T A 7: 112,091,436 I762K possibly damaging Het
Vmn2r53 T C 7: 12,600,932 H267R probably benign Het
Wnt2b A G 3: 104,953,197 probably benign Het
Xirp1 T C 9: 120,018,417 N28D possibly damaging Het
Zeb1 T C 18: 5,767,138 S550P probably benign Het
Other mutations in C9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:C9 APN 15 6486656 missense probably benign 0.04
IGL00229:C9 APN 15 6483231 missense possibly damaging 0.68
IGL00647:C9 APN 15 6483083 missense probably benign 0.43
IGL01618:C9 APN 15 6459668 missense probably benign 0.38
IGL02530:C9 APN 15 6497132 missense probably benign
R0267:C9 UTSW 15 6467458 missense probably benign 0.00
R0477:C9 UTSW 15 6458183 missense probably benign 0.25
R0552:C9 UTSW 15 6445437 missense probably damaging 0.98
R0701:C9 UTSW 15 6467421 missense probably damaging 1.00
R0792:C9 UTSW 15 6486762 missense probably damaging 1.00
R1281:C9 UTSW 15 6489840 missense possibly damaging 0.80
R1384:C9 UTSW 15 6458934 missense probably benign 0.08
R1522:C9 UTSW 15 6486762 missense probably damaging 1.00
R1988:C9 UTSW 15 6483138 frame shift probably null
R2229:C9 UTSW 15 6445420 missense possibly damaging 0.95
R2406:C9 UTSW 15 6483299 missense possibly damaging 0.76
R3720:C9 UTSW 15 6483119 missense possibly damaging 0.95
R3723:C9 UTSW 15 6483080 missense possibly damaging 0.77
R3929:C9 UTSW 15 6467458 missense probably benign 0.00
R4371:C9 UTSW 15 6491484 missense probably damaging 1.00
R4615:C9 UTSW 15 6491463 missense probably damaging 0.99
R4616:C9 UTSW 15 6491463 missense probably damaging 0.99
R4618:C9 UTSW 15 6491463 missense probably damaging 0.99
R4749:C9 UTSW 15 6489830 missense probably benign 0.19
R4764:C9 UTSW 15 6459643 missense probably damaging 1.00
R5544:C9 UTSW 15 6497027 missense probably damaging 0.99
R5723:C9 UTSW 15 6486816 missense probably damaging 1.00
R5813:C9 UTSW 15 6497126 missense probably benign 0.05
R6735:C9 UTSW 15 6489906 missense probably benign 0.06
R6754:C9 UTSW 15 6489943 nonsense probably null
R6956:C9 UTSW 15 6445464 missense probably benign
R7706:C9 UTSW 15 6458921 missense probably benign 0.08
R7791:C9 UTSW 15 6489878 missense possibly damaging 0.82
R7893:C9 UTSW 15 6483245 missense possibly damaging 0.94
R8185:C9 UTSW 15 6491397 missense probably damaging 1.00
Z1177:C9 UTSW 15 6491519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCTGCATGTTGAACAGCAGAC -3'
(R):5'- AGCCCTTGTTGAGGAGCCATTG -3'

Sequencing Primer
(F):5'- tcacctgagaccatcagaaaac -3'
(R):5'- AGGAGCCATTGCACTTGG -3'
Posted On2013-11-07