Incidental Mutation 'R0927:Tcf7l2'
ID80579
Institutional Source Beutler Lab
Gene Symbol Tcf7l2
Ensembl Gene ENSMUSG00000024985
Gene Nametranscription factor 7 like 2, T cell specific, HMG box
SynonymsTCF4B, mTcf-4B, mTcf-4E, TCF4E, Tcf4, Tcf-4
MMRRC Submission 039074-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0927 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location55741810-55933654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55918955 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 340 (M340V)
Ref Sequence ENSEMBL: ENSMUSP00000107287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041717] [ENSMUST00000061496] [ENSMUST00000111646] [ENSMUST00000111653] [ENSMUST00000111654] [ENSMUST00000111656] [ENSMUST00000111657] [ENSMUST00000111658] [ENSMUST00000111659] [ENSMUST00000111662] [ENSMUST00000142291] [ENSMUST00000148666] [ENSMUST00000153888]
Predicted Effect probably damaging
Transcript: ENSMUST00000041717
AA Change: M335V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042950
Gene: ENSMUSG00000024985
AA Change: M335V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.5e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000061496
AA Change: M335V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050081
Gene: ENSMUSG00000024985
AA Change: M335V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111646
AA Change: M175V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107273
Gene: ENSMUSG00000024985
AA Change: M175V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 76 2.4e-37 PFAM
HMG 166 236 1.16e-22 SMART
low complexity region 242 250 N/A INTRINSIC
c-clamp 278 298 2.25e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111653
AA Change: M340V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107280
Gene: ENSMUSG00000024985
AA Change: M340V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.1e-95 PFAM
HMG 331 401 1.16e-22 SMART
low complexity region 407 415 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111654
AA Change: M354V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107281
Gene: ENSMUSG00000024985
AA Change: M354V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 4.2e-93 PFAM
HMG 345 415 1.16e-22 SMART
low complexity region 421 429 N/A INTRINSIC
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111656
AA Change: M335V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107283
Gene: ENSMUSG00000024985
AA Change: M335V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.5e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 438 458 2.25e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111657
AA Change: M335V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107284
Gene: ENSMUSG00000024985
AA Change: M335V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.1e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 438 468 2.08e-14 SMART
low complexity region 471 498 N/A INTRINSIC
low complexity region 519 539 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111658
AA Change: M359V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107286
Gene: ENSMUSG00000024985
AA Change: M359V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 4.5e-93 PFAM
HMG 350 420 1.16e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111659
AA Change: M340V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107287
Gene: ENSMUSG00000024985
AA Change: M340V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-96 PFAM
HMG 331 401 1.16e-22 SMART
low complexity region 407 415 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111662
AA Change: M335V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107291
Gene: ENSMUSG00000024985
AA Change: M335V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-103 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 421 442 1.23e-2 SMART
c-clamp 446 476 1.35e-13 SMART
low complexity region 479 506 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000127233
AA Change: M327V
SMART Domains Protein: ENSMUSP00000123428
Gene: ENSMUSG00000024985
AA Change: M327V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 229 9.3e-98 PFAM
HMG 319 389 1.16e-22 SMART
low complexity region 395 403 N/A INTRINSIC
c-clamp 414 434 2.25e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142291
AA Change: M175V

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118042
Gene: ENSMUSG00000024985
AA Change: M175V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 76 5e-40 PFAM
SCOP:d1j46a_ 164 178 5e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145249
Predicted Effect probably damaging
Transcript: ENSMUST00000148666
AA Change: M205V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119759
Gene: ENSMUSG00000024985
AA Change: M205V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 10 106 5.7e-39 PFAM
HMG 196 265 1.02e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153888
AA Change: M316V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118661
Gene: ENSMUSG00000024985
AA Change: M316V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 217 1.2e-64 PFAM
HMG 307 377 1.16e-22 SMART
low complexity region 383 391 N/A INTRINSIC
c-clamp 402 432 5.29e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high mobility group (HMG) box-containing transcription factor that plays a key role in the Wnt signaling pathway. The protein has been implicated in blood glucose homeostasis. Genetic variants of this gene are associated with increased risk of type 2 diabetes. Several transcript variants encoding multiple different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
PHENOTYPE: Animals homozygous for a targeted mutation exhibit intestinal epithelia abnormalities and die shortly after birth. Mice heterozygous for some mutations display abnormalities in glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,402,319 L363P probably damaging Het
Adam12 T A 7: 133,998,230 H85L probably damaging Het
Adam34 A T 8: 43,651,584 H341Q probably damaging Het
Adam7 A G 14: 68,516,684 L322P probably damaging Het
Adcy5 T A 16: 35,156,243 S49T probably benign Het
Arfgap2 T C 2: 91,273,805 S374P probably benign Het
Arpp19 G A 9: 75,037,685 probably benign Het
Baz1a T C 12: 54,894,988 K1478E probably damaging Het
Cdc27 G T 11: 104,505,641 A812E possibly damaging Het
Chtf8 G A 8: 106,885,518 T263I probably damaging Het
Clcn6 T C 4: 148,029,392 N70D probably benign Het
Cntnap5c A T 17: 58,042,558 T289S possibly damaging Het
Dzip3 T C 16: 48,975,477 N177S probably damaging Het
Edar G T 10: 58,629,491 probably null Het
Enam T A 5: 88,494,060 N244K possibly damaging Het
Fbxw10 A G 11: 62,876,944 K874E probably damaging Het
Glra3 A G 8: 56,125,204 E432G possibly damaging Het
Gm13084 A T 4: 143,812,808 D38E probably benign Het
Gm13088 T A 4: 143,654,220 H411L possibly damaging Het
Gm5346 A T 8: 43,625,123 M688K probably benign Het
Grin3b G A 10: 79,971,228 R110Q probably benign Het
Herc3 T A 6: 58,868,763 V423D possibly damaging Het
Ifit2 A T 19: 34,573,584 T175S probably benign Het
Kcnj8 T G 6: 142,565,901 I327L possibly damaging Het
Kcns2 A T 15: 34,839,096 I202F probably benign Het
Kif12 T C 4: 63,168,773 R305G possibly damaging Het
Limch1 A G 5: 66,997,233 D362G probably damaging Het
Lrba T C 3: 86,780,233 I2815T probably damaging Het
Lrrtm1 G T 6: 77,244,860 M433I probably damaging Het
Myh7b A G 2: 155,620,120 D312G probably damaging Het
Nrxn1 A T 17: 90,037,330 I382N probably damaging Het
Nudt6 C T 3: 37,405,353 R161H probably benign Het
Olfr1490 T A 19: 13,654,452 W8R probably damaging Het
Olfr734 A T 14: 50,320,729 Y35* probably null Het
Olfr744 A C 14: 50,618,587 M122L possibly damaging Het
Olfr857 C T 9: 19,713,649 A274V probably benign Het
Pmf1 A T 3: 88,396,062 V64D probably damaging Het
Pomgnt1 T A 4: 116,151,851 V29D probably damaging Het
Prex1 C T 2: 166,586,537 A925T probably benign Het
Pus3 A G 9: 35,565,031 Y72C probably damaging Het
Rnf20 T C 4: 49,642,176 S247P probably damaging Het
Rnf213 T A 11: 119,414,570 D542E probably benign Het
Sidt1 T C 16: 44,243,532 D786G probably benign Het
Sirt6 A T 10: 81,622,641 D219E probably damaging Het
Slc36a2 A T 11: 55,181,585 I67N probably damaging Het
Slc47a1 A G 11: 61,373,422 F57S probably damaging Het
Spg11 T A 2: 122,094,487 T756S probably damaging Het
Sptbn1 C A 11: 30,121,591 R1447L probably damaging Het
Thap1 T C 8: 26,162,705 V157A probably benign Het
Ubash3b G A 9: 41,023,557 Q354* probably null Het
Ubtd1 G A 19: 42,032,021 W68* probably null Het
Wdr64 G T 1: 175,793,081 R793L probably damaging Het
Zbtb24 C T 10: 41,451,436 T106I probably benign Het
Zbtb26 T C 2: 37,436,325 N233S possibly damaging Het
Zcchc24 A T 14: 25,757,161 N99K possibly damaging Het
Other mutations in Tcf7l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Tcf7l2 APN 19 55917421 missense probably damaging 1.00
IGL01013:Tcf7l2 APN 19 55919627 splice site probably benign
IGL02871:Tcf7l2 APN 19 55918997 missense probably damaging 1.00
banned UTSW 19 55931432 critical splice acceptor site probably null
PIT4468001:Tcf7l2 UTSW 19 55742388 missense probably damaging 1.00
R1078:Tcf7l2 UTSW 19 55743195 missense probably benign 0.19
R4580:Tcf7l2 UTSW 19 55919036 missense probably damaging 1.00
R4721:Tcf7l2 UTSW 19 55931454 missense possibly damaging 0.89
R4814:Tcf7l2 UTSW 19 55924072 nonsense probably null
R4957:Tcf7l2 UTSW 19 55931432 critical splice acceptor site probably null
R5222:Tcf7l2 UTSW 19 55898612 missense probably benign
R5484:Tcf7l2 UTSW 19 55919508 splice site probably null
R5808:Tcf7l2 UTSW 19 55908541 missense probably damaging 1.00
R5914:Tcf7l2 UTSW 19 55898560 missense probably benign 0.00
R6077:Tcf7l2 UTSW 19 55917436 nonsense probably null
R6116:Tcf7l2 UTSW 19 55919014 missense probably damaging 1.00
R6861:Tcf7l2 UTSW 19 55742523 missense probably damaging 1.00
R6970:Tcf7l2 UTSW 19 55755048 missense probably benign 0.44
R7009:Tcf7l2 UTSW 19 55894733 critical splice donor site probably null
R7382:Tcf7l2 UTSW 19 55926740 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGAAGGAGCATGGGATCTGCTTTG -3'
(R):5'- TCCGGGCCAGCTCGTAGTATTTTG -3'

Sequencing Primer
(F):5'- GGATCTGCTTTGGGGGAAG -3'
(R):5'- ACCCATTGCTGTATCTATGACAGG -3'
Posted On2013-11-07