Incidental Mutation 'R0881:Mslnl'
ID 80580
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Name mesothelin-like
Synonyms
MMRRC Submission 039048-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0881 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 25736040-25748330 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25742965 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 138 (H138L)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
AlphaFold Q8C160
Predicted Effect possibly damaging
Transcript: ENSMUST00000047098
AA Change: H138L

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: H138L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 93.0%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abcc9 T A 6: 142,646,303 I732F probably damaging Het
Adam10 T C 9: 70,746,237 S248P probably damaging Het
Adam18 A T 8: 24,672,143 probably benign Het
Angel2 G A 1: 190,937,464 E114K probably damaging Het
Arhgap29 A G 3: 122,014,679 T1169A probably damaging Het
Atp13a2 T A 4: 141,003,931 M759K probably damaging Het
Atxn2l A G 7: 126,496,596 S450P probably damaging Het
B3glct T A 5: 149,739,569 V264E probably damaging Het
Bbx A G 16: 50,220,600 probably benign Het
Bmp3 A G 5: 98,872,602 N295D possibly damaging Het
C9 G A 15: 6,458,868 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cdan1 A T 2: 120,720,985 V1039E probably damaging Het
Dennd4a T C 9: 64,851,383 probably null Het
Ext1 A G 15: 53,344,483 L294P probably benign Het
Fsip2 C A 2: 82,986,273 H4117N possibly damaging Het
Itga8 C T 2: 12,262,192 probably null Het
Itln1 G T 1: 171,533,381 H48N probably benign Het
Kcna5 T A 6: 126,534,994 H57L probably benign Het
Klhdc4 A T 8: 121,799,487 Y304* probably null Het
Klhl25 A G 7: 75,866,279 Y6C probably damaging Het
Lars C T 18: 42,214,786 V991M probably benign Het
Med20 T C 17: 47,611,680 M1T probably null Het
Mycbp2 T C 14: 103,220,013 I1583V probably benign Het
Nipbl A C 15: 8,307,612 V2093G probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr340 T G 2: 36,453,440 L285R probably damaging Het
Olfr557 T A 7: 102,699,084 V282D possibly damaging Het
Olfr943 A G 9: 39,184,688 K170R probably benign Het
Opalin T C 19: 41,063,981 probably null Het
Pgm1 A T 5: 64,093,008 T9S unknown Het
Piwil2 A C 14: 70,408,927 S387A probably benign Het
Polr1c T C 17: 46,244,613 T240A possibly damaging Het
Polr3c A G 3: 96,723,847 M118T probably damaging Het
Pth1r C T 9: 110,731,573 C42Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rictor A T 15: 6,791,670 M1492L probably benign Het
Rrbp1 T A 2: 143,953,253 Y1277F probably benign Het
Scgb3a2 T G 18: 43,764,484 probably benign Het
Skint1 G A 4: 112,028,857 S327N probably benign Het
Steap4 A T 5: 7,980,388 S415C probably benign Het
Tex48 A G 4: 63,611,991 probably benign Het
Tox2 T A 2: 163,321,445 S502T probably benign Het
Usp47 T A 7: 112,091,436 I762K possibly damaging Het
Vmn2r53 T C 7: 12,600,932 H267R probably benign Het
Wnt2b A G 3: 104,953,197 probably benign Het
Xirp1 T C 9: 120,018,417 N28D possibly damaging Het
Zeb1 T C 18: 5,767,138 S550P probably benign Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25743667 unclassified probably benign
IGL01629:Mslnl APN 17 25744775 missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25746151 missense probably benign 0.07
IGL02408:Mslnl APN 17 25747998 missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25744103 critical splice donor site probably null
IGL03387:Mslnl APN 17 25744077 missense probably benign 0.06
R0561:Mslnl UTSW 17 25743203 nonsense probably null
R1295:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1296:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1582:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1629:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1630:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1631:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1632:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1794:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1850:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1866:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1876:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1914:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2166:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2241:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2243:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2247:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2282:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2284:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2852:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2877:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2878:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2919:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2920:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3026:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3405:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3406:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3411:Mslnl UTSW 17 25744517 missense probably benign 0.05
R3434:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3546:Mslnl UTSW 17 25744969 missense probably damaging 0.98
R3612:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3729:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3730:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3802:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3804:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3894:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3895:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4454:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4455:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4456:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4457:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4561:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4562:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4564:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4600:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4601:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4610:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4704:Mslnl UTSW 17 25738978 missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25738968 nonsense probably null
R5257:Mslnl UTSW 17 25746165 missense probably benign 0.00
R5456:Mslnl UTSW 17 25743159 missense probably damaging 0.98
R5645:Mslnl UTSW 17 25737842 missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25746775 missense probably benign 0.00
R6083:Mslnl UTSW 17 25737902 missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25744557 missense probably damaging 1.00
R6761:Mslnl UTSW 17 25746073 missense probably damaging 1.00
R7058:Mslnl UTSW 17 25743212 missense probably benign 0.03
R7156:Mslnl UTSW 17 25743210 missense probably benign 0.20
R7467:Mslnl UTSW 17 25736921 start codon destroyed probably benign 0.33
R7687:Mslnl UTSW 17 25743183 missense probably damaging 0.97
R7807:Mslnl UTSW 17 25746777 missense probably benign 0.03
R8682:Mslnl UTSW 17 25746988 missense probably benign
R8735:Mslnl UTSW 17 25745088 missense probably benign 0.09
R8742:Mslnl UTSW 17 25745073 missense probably damaging 1.00
R9208:Mslnl UTSW 17 25742720 missense possibly damaging 0.94
RF007:Mslnl UTSW 17 25743228 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GTGACAGTCCCCTTATCATGTGCC -3'
(R):5'- GCAGTCACAATTTGTGCTGCCTCC -3'

Sequencing Primer
(F):5'- ATCATGTGCCTGCCAGTG -3'
(R):5'- TCTGAAGCACTGAGCTGTAGG -3'
Posted On 2013-11-07