Incidental Mutation 'R0882:Prr5l'
ID80606
Institutional Source Beutler Lab
Gene Symbol Prr5l
Ensembl Gene ENSMUSG00000032841
Gene Nameproline rich 5 like
Synonyms
MMRRC Submission 039049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R0882 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location101714285-101883027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101758541 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 88 (E88G)
Ref Sequence ENSEMBL: ENSMUSP00000122996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043845] [ENSMUST00000125985] [ENSMUST00000154525] [ENSMUST00000163762] [ENSMUST00000171088]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043845
AA Change: E88G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042167
Gene: ENSMUSG00000032841
AA Change: E88G

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 47 152 5.4e-15 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000125985
AA Change: E88G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122996
Gene: ENSMUSG00000032841
AA Change: E88G

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 128 3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141814
SMART Domains Protein: ENSMUSP00000118537
Gene: ENSMUSG00000032841

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
low complexity region 56 69 N/A INTRINSIC
low complexity region 93 107 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154525
AA Change: E88G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120192
Gene: ENSMUSG00000032841
AA Change: E88G

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 95 2.8e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163762
AA Change: E88G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127530
Gene: ENSMUSG00000032841
AA Change: E88G

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 177 2.8e-36 PFAM
low complexity region 323 332 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171088
AA Change: E88G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130152
Gene: ENSMUSG00000032841
AA Change: E88G

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 177 2.8e-36 PFAM
low complexity region 323 332 N/A INTRINSIC
Meta Mutation Damage Score 0.2275 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Adh1 A T 3: 138,286,797 I225F possibly damaging Het
Agap2 A G 10: 127,087,450 K691E unknown Het
Alcam T C 16: 52,253,210 D564G possibly damaging Het
Apbb2 T A 5: 66,400,255 T289S probably damaging Het
BC005561 T C 5: 104,519,009 S466P probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cep68 T C 11: 20,239,393 I540V probably benign Het
Ctla4 T C 1: 60,909,238 V23A probably benign Het
Dnah7b T A 1: 46,340,132 D3675E probably benign Het
Fam209 G T 2: 172,472,635 V15F probably benign Het
Fat3 A G 9: 16,031,368 V1236A possibly damaging Het
Gabbr2 A G 4: 46,718,904 I38T probably damaging Het
Gdpd4 T C 7: 97,966,298 I110T probably damaging Het
Gm4841 C T 18: 60,269,780 A414T possibly damaging Het
Gtf3c4 A T 2: 28,834,770 Y176N probably damaging Het
Hist2h2bb G A 3: 96,269,744 probably null Het
Igsf9b T C 9: 27,319,316 Y264H probably damaging Het
Itih4 A T 14: 30,892,274 N394Y probably damaging Het
Kmt2c T C 5: 25,295,607 T3815A possibly damaging Het
Lrwd1 T C 5: 136,123,400 probably null Het
Mc3r A G 2: 172,249,791 K311R probably benign Het
Myb T C 10: 21,156,360 T41A possibly damaging Het
Nfix T C 8: 84,727,925 D201G probably damaging Het
Nos1 T C 5: 117,947,447 V1280A probably damaging Het
Olfr160 T C 9: 37,711,872 M136V probably benign Het
Olfr586 A C 7: 103,122,575 S66A probably benign Het
Pcdh15 A G 10: 74,342,656 T582A probably damaging Het
Pcdhb12 C A 18: 37,437,322 A507E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pkp2 C A 16: 16,269,711 A753E probably damaging Het
Plekha3 G A 2: 76,682,798 V76I possibly damaging Het
Pnpla6 T C 8: 3,517,081 L33P probably damaging Het
Pot1b C T 17: 55,666,400 probably benign Het
Prss57 G A 10: 79,785,865 H97Y probably damaging Het
Rttn C T 18: 88,973,689 Q131* probably null Het
Scaf11 G T 15: 96,418,295 S1129R possibly damaging Het
Slc25a20 T A 9: 108,681,990 M185K possibly damaging Het
Sorbs3 T A 14: 70,207,572 E19V probably damaging Het
Srgap2 A T 1: 131,289,515 C1020S probably benign Het
Tmem109 T C 19: 10,871,841 R217G possibly damaging Het
Trio A T 15: 27,732,894 I2967N probably damaging Het
Vars2 T C 17: 35,657,299 E899G probably benign Het
Vmn2r109 A G 17: 20,554,580 probably benign Het
Vps53 A G 11: 76,082,659 F170L probably damaging Het
Zc2hc1a G A 3: 7,526,362 S149N possibly damaging Het
Zfp820 A G 17: 21,823,836 probably benign Het
Zhx3 A C 2: 160,780,709 F513V probably damaging Het
Other mutations in Prr5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Prr5l APN 2 101772120 splice site probably benign
IGL02946:Prr5l APN 2 101772184 splice site probably null
PIT4618001:Prr5l UTSW 2 101758530 missense probably damaging 0.99
R0652:Prr5l UTSW 2 101772290 missense possibly damaging 0.94
R0722:Prr5l UTSW 2 101717474 splice site probably benign
R1962:Prr5l UTSW 2 101758509 critical splice donor site probably null
R3013:Prr5l UTSW 2 101734705 missense probably damaging 1.00
R4564:Prr5l UTSW 2 101746749 missense probably damaging 1.00
R4604:Prr5l UTSW 2 101729448 missense probably benign 0.44
R4902:Prr5l UTSW 2 101797682 utr 5 prime probably benign
R5338:Prr5l UTSW 2 101717107 missense probably benign 0.00
R6279:Prr5l UTSW 2 101717420 nonsense probably null
R6792:Prr5l UTSW 2 101717424 missense probably benign 0.00
R7214:Prr5l UTSW 2 101729432 missense probably benign
R7299:Prr5l UTSW 2 101717286 missense probably damaging 1.00
R7301:Prr5l UTSW 2 101717286 missense probably damaging 1.00
R7672:Prr5l UTSW 2 101734738 missense probably damaging 1.00
R7702:Prr5l UTSW 2 101717097 missense probably benign 0.04
R8086:Prr5l UTSW 2 101741364 missense probably benign 0.00
R8116:Prr5l UTSW 2 101797574 frame shift probably null
R8297:Prr5l UTSW 2 101741285 critical splice donor site probably null
RF028:Prr5l UTSW 2 101797573 frame shift probably null
RF033:Prr5l UTSW 2 101797573 frame shift probably null
RF039:Prr5l UTSW 2 101797573 frame shift probably null
X0018:Prr5l UTSW 2 101717259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCTCCACTCACATCAGGGACC -3'
(R):5'- AGCAGAGAGCATTCCTTCCTCCAG -3'

Sequencing Primer
(F):5'- CTCACATCAGGGACCAAGTG -3'
(R):5'- CCAGCCTCGGTCCCTAC -3'
Posted On2013-11-07