Incidental Mutation 'R0928:Ccdc144b'
ID80616
Institutional Source Beutler Lab
Gene Symbol Ccdc144b
Ensembl Gene ENSMUSG00000047696
Gene Namecoiled-coil domain containing 144B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0928 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36007244-36053547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 36025366 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 258 (N258K)
Ref Sequence ENSEMBL: ENSMUSP00000142910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166644] [ENSMUST00000196964] [ENSMUST00000200469]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062056
AA Change: N258K

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058450
Gene: ENSMUSG00000047696
AA Change: N258K

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
coiled coil region 231 327 N/A INTRINSIC
Pfam:DUF3496 382 485 4.1e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124469
Predicted Effect possibly damaging
Transcript: ENSMUST00000166644
AA Change: N258K

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132995
Gene: ENSMUSG00000047696
AA Change: N258K

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
coiled coil region 231 327 N/A INTRINSIC
Pfam:DUF3496 381 488 1.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196964
SMART Domains Protein: ENSMUSP00000142406
Gene: ENSMUSG00000047696

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200469
AA Change: N258K

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142910
Gene: ENSMUSG00000047696
AA Change: N258K

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
coiled coil region 231 327 N/A INTRINSIC
Pfam:DUF3496 381 488 1.6e-45 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 93.0%
  • 20x: 75.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,582 D745G possibly damaging Het
4931406P16Rik A T 7: 34,248,246 probably null Het
Abca12 T A 1: 71,349,174 D179V probably benign Het
Abcc1 T C 16: 14,389,985 probably null Het
Adad1 G A 3: 37,076,740 probably null Het
Apobec4 T C 1: 152,756,277 Y19H probably damaging Het
Bco2 T A 9: 50,545,931 T104S probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
Ccs T C 19: 4,825,960 E184G probably damaging Het
Cfap70 T G 14: 20,443,919 K97N probably damaging Het
Daam2 T C 17: 49,488,227 I313V probably benign Het
Dach1 T C 14: 97,915,832 S467G probably damaging Het
Dnah11 A G 12: 118,045,562 S2122P probably damaging Het
Dnah3 T A 7: 120,030,051 D1427V probably damaging Het
Dnaic1 T C 4: 41,602,566 F97L possibly damaging Het
Dsc1 A T 18: 20,110,249 probably null Het
En2 A T 5: 28,170,331 K291* probably null Het
Eps15 T C 4: 109,312,963 V154A possibly damaging Het
Etnk1 A G 6: 143,184,703 I183V probably benign Het
Fcrlb A T 1: 170,907,940 V255D possibly damaging Het
Fry A T 5: 150,437,084 E52V probably damaging Het
Gm8251 C A 1: 44,057,228 S1570I possibly damaging Het
Gtf2h4 T C 17: 35,670,885 Y152C probably damaging Het
Hao1 C A 2: 134,505,616 L256F possibly damaging Het
Helz T A 11: 107,626,693 I685K probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Izumo2 A T 7: 44,715,423 I171F possibly damaging Het
Krt83 C A 15: 101,491,280 C57F probably benign Het
Mapkbp1 A G 2: 120,015,368 H400R probably benign Het
Megf6 T A 4: 154,177,047 V43E probably damaging Het
Mut T C 17: 40,937,283 I67T probably benign Het
Ninl A T 2: 150,963,475 V396E probably damaging Het
Nvl A T 1: 181,093,902 V844E probably benign Het
Olfr11 C T 13: 21,638,956 C189Y probably damaging Het
P2rx3 A T 2: 85,035,298 M1K probably null Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Ppp3r2 C A 4: 49,681,439 probably null Het
Prmt6 C T 3: 110,250,682 G97D probably damaging Het
Prmt9 T C 8: 77,581,176 V823A probably damaging Het
Skint11 C A 4: 114,244,601 D79E possibly damaging Het
Slc17a8 T A 10: 89,598,683 H194L probably damaging Het
Slco6c1 T A 1: 97,104,848 I293F possibly damaging Het
Tcl1b4 A T 12: 105,202,606 H43L probably benign Het
Tm9sf1 T C 14: 55,636,457 D528G probably damaging Het
Tpbpb C T 13: 60,902,175 V47I probably benign Het
Ttc37 T G 13: 76,113,592 L142W probably damaging Het
Ttn G T 2: 76,907,532 probably benign Het
Usp28 T G 9: 49,030,891 S341A possibly damaging Het
Vwa5a T C 9: 38,728,007 Y345H probably damaging Het
Wdr11 C A 7: 129,606,653 D377E probably damaging Het
Zer1 A G 2: 30,101,763 probably null Het
Other mutations in Ccdc144b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Ccdc144b APN 3 36019989 missense probably damaging 1.00
IGL00773:Ccdc144b APN 3 36035337 missense probably damaging 1.00
IGL01409:Ccdc144b APN 3 36025928 missense possibly damaging 0.77
IGL01791:Ccdc144b APN 3 36035267 critical splice donor site probably benign 0.00
IGL02307:Ccdc144b APN 3 36018867 missense possibly damaging 0.95
IGL02374:Ccdc144b APN 3 36019959 missense possibly damaging 0.83
IGL02673:Ccdc144b APN 3 36046699 splice site probably benign
IGL02727:Ccdc144b APN 3 36032916 missense possibly damaging 0.66
R0355:Ccdc144b UTSW 3 36046905 splice site probably benign
R0833:Ccdc144b UTSW 3 36020213 splice site probably benign
R1595:Ccdc144b UTSW 3 36018997 missense probably damaging 0.99
R1598:Ccdc144b UTSW 3 36018997 missense probably damaging 0.99
R2011:Ccdc144b UTSW 3 36010678 nonsense probably null
R2255:Ccdc144b UTSW 3 36019950 missense probably benign 0.00
R2921:Ccdc144b UTSW 3 36025928 missense probably null 0.01
R4659:Ccdc144b UTSW 3 36025954 missense possibly damaging 0.90
R4764:Ccdc144b UTSW 3 36010660 makesense probably null
R4929:Ccdc144b UTSW 3 36035338 missense probably damaging 0.99
R5631:Ccdc144b UTSW 3 36046877 missense probably damaging 0.99
R5755:Ccdc144b UTSW 3 36017693 missense probably benign
R5849:Ccdc144b UTSW 3 36032877 missense possibly damaging 0.81
R5894:Ccdc144b UTSW 3 36019975 missense possibly damaging 0.91
R5968:Ccdc144b UTSW 3 36010691 missense probably benign 0.00
R6961:Ccdc144b UTSW 3 36050617 missense possibly damaging 0.66
R6963:Ccdc144b UTSW 3 36050662 missense probably benign 0.30
R7248:Ccdc144b UTSW 3 36025937 missense probably benign 0.00
R7380:Ccdc144b UTSW 3 36025921 missense possibly damaging 0.68
R7462:Ccdc144b UTSW 3 36025906 splice site probably null
R7612:Ccdc144b UTSW 3 36025357 missense possibly damaging 0.79
R7637:Ccdc144b UTSW 3 36046876 missense probably damaging 0.98
R8025:Ccdc144b UTSW 3 36018987 missense probably damaging 0.97
X0011:Ccdc144b UTSW 3 36025948 missense possibly damaging 0.66
X0057:Ccdc144b UTSW 3 36018901 nonsense probably null
Z1176:Ccdc144b UTSW 3 36018888 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CGCTGGAGGCTCATTCATCCCC -3'
(R):5'- ACTGCATACAAAAGTACACGGCTGC -3'

Sequencing Primer
(F):5'- CCCACGGGTGTGTGAGTG -3'
(R):5'- gggaggaaagaggggaagg -3'
Posted On2013-11-07