Incidental Mutation 'R0882:Adh1'
ID80619
Institutional Source Beutler Lab
Gene Symbol Adh1
Ensembl Gene ENSMUSG00000074207
Gene Namealcohol dehydrogenase 1 (class I)
Synonymsclass I alcohol dehydrogenase, ADH-AA, Adh1tl, Adh-1e, Adh-1t, Adh-1-t, Adh-1, Adh1-t, Adh1-e
MMRRC Submission 039049-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0882 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138260991-138290698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138286797 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 225 (I225F)
Ref Sequence ENSEMBL: ENSMUSP00000004232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004232] [ENSMUST00000159159]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004232
AA Change: I225F

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000004232
Gene: ENSMUSG00000074207
AA Change: I225F

DomainStartEndE-ValueType
Pfam:ADH_N 34 161 1.3e-25 PFAM
Pfam:ADH_zinc_N 203 337 3.6e-27 PFAM
Pfam:ADH_zinc_N_2 236 369 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162032
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes class I alcohol dehydrogenase, gamma subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class I alcohol dehydrogenase, consisting of several homo- and heterodimers of alpha, beta, and gamma subunits, exhibits high activity for ethanol oxidation and plays a major role in ethanol catabolism. Three genes encoding alpha, beta and gamma subunits are tandemly organized in a genomic segment as a gene cluster. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired metabolism of (and sensitivity to) ethanol and retinol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Agap2 A G 10: 127,087,450 K691E unknown Het
Alcam T C 16: 52,253,210 D564G possibly damaging Het
Apbb2 T A 5: 66,400,255 T289S probably damaging Het
BC005561 T C 5: 104,519,009 S466P probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cep68 T C 11: 20,239,393 I540V probably benign Het
Ctla4 T C 1: 60,909,238 V23A probably benign Het
Dnah7b T A 1: 46,340,132 D3675E probably benign Het
Fam209 G T 2: 172,472,635 V15F probably benign Het
Fat3 A G 9: 16,031,368 V1236A possibly damaging Het
Gabbr2 A G 4: 46,718,904 I38T probably damaging Het
Gdpd4 T C 7: 97,966,298 I110T probably damaging Het
Gm4841 C T 18: 60,269,780 A414T possibly damaging Het
Gtf3c4 A T 2: 28,834,770 Y176N probably damaging Het
Hist2h2bb G A 3: 96,269,744 probably null Het
Igsf9b T C 9: 27,319,316 Y264H probably damaging Het
Itih4 A T 14: 30,892,274 N394Y probably damaging Het
Kmt2c T C 5: 25,295,607 T3815A possibly damaging Het
Lrwd1 T C 5: 136,123,400 probably null Het
Mc3r A G 2: 172,249,791 K311R probably benign Het
Myb T C 10: 21,156,360 T41A possibly damaging Het
Nfix T C 8: 84,727,925 D201G probably damaging Het
Nos1 T C 5: 117,947,447 V1280A probably damaging Het
Olfr160 T C 9: 37,711,872 M136V probably benign Het
Olfr586 A C 7: 103,122,575 S66A probably benign Het
Pcdh15 A G 10: 74,342,656 T582A probably damaging Het
Pcdhb12 C A 18: 37,437,322 A507E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pkp2 C A 16: 16,269,711 A753E probably damaging Het
Plekha3 G A 2: 76,682,798 V76I possibly damaging Het
Pnpla6 T C 8: 3,517,081 L33P probably damaging Het
Pot1b C T 17: 55,666,400 probably benign Het
Prr5l T C 2: 101,758,541 E88G possibly damaging Het
Prss57 G A 10: 79,785,865 H97Y probably damaging Het
Rttn C T 18: 88,973,689 Q131* probably null Het
Scaf11 G T 15: 96,418,295 S1129R possibly damaging Het
Slc25a20 T A 9: 108,681,990 M185K possibly damaging Het
Sorbs3 T A 14: 70,207,572 E19V probably damaging Het
Srgap2 A T 1: 131,289,515 C1020S probably benign Het
Tmem109 T C 19: 10,871,841 R217G possibly damaging Het
Trio A T 15: 27,732,894 I2967N probably damaging Het
Vars2 T C 17: 35,657,299 E899G probably benign Het
Vmn2r109 A G 17: 20,554,580 probably benign Het
Vps53 A G 11: 76,082,659 F170L probably damaging Het
Zc2hc1a G A 3: 7,526,362 S149N possibly damaging Het
Zfp820 A G 17: 21,823,836 probably benign Het
Zhx3 A C 2: 160,780,709 F513V probably damaging Het
Other mutations in Adh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Adh1 APN 3 138282499 missense probably benign 0.00
IGL00510:Adh1 APN 3 138289907 missense probably damaging 1.00
IGL01326:Adh1 APN 3 138286911 missense probably damaging 1.00
IGL01662:Adh1 APN 3 138282751 missense possibly damaging 0.96
IGL02090:Adh1 APN 3 138282785 missense possibly damaging 0.95
PIT4687001:Adh1 UTSW 3 138289835 missense probably damaging 1.00
R0413:Adh1 UTSW 3 138280432 missense probably benign 0.00
R1426:Adh1 UTSW 3 138286795 missense probably damaging 1.00
R1464:Adh1 UTSW 3 138288747 critical splice acceptor site probably null
R1464:Adh1 UTSW 3 138288747 critical splice acceptor site probably null
R1901:Adh1 UTSW 3 138288797 missense probably benign 0.00
R2056:Adh1 UTSW 3 138286915 missense probably damaging 1.00
R2095:Adh1 UTSW 3 138282796 missense probably damaging 1.00
R3155:Adh1 UTSW 3 138280489 missense probably damaging 0.99
R3752:Adh1 UTSW 3 138288794 missense probably benign
R3795:Adh1 UTSW 3 138279765 missense possibly damaging 0.85
R4351:Adh1 UTSW 3 138280497 missense probably benign 0.21
R4698:Adh1 UTSW 3 138282513 missense probably benign 0.05
R4747:Adh1 UTSW 3 138288881 missense probably damaging 1.00
R5626:Adh1 UTSW 3 138280410 missense probably benign 0.04
R6014:Adh1 UTSW 3 138286798 missense probably benign 0.00
R6060:Adh1 UTSW 3 138286783 missense probably damaging 1.00
R6225:Adh1 UTSW 3 138289804 missense probably benign 0.04
R6637:Adh1 UTSW 3 138282470 nonsense probably null
R7129:Adh1 UTSW 3 138280474 missense probably damaging 0.98
R7288:Adh1 UTSW 3 138282732 missense probably benign
R7291:Adh1 UTSW 3 138282808 missense probably damaging 1.00
R7367:Adh1 UTSW 3 138290551 missense probably benign 0.04
R7378:Adh1 UTSW 3 138288887 splice site probably null
R7453:Adh1 UTSW 3 138289941 critical splice donor site probably null
R7613:Adh1 UTSW 3 138286831 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACAGCAAGGCAATATGTGCAGTG -3'
(R):5'- CAACAGCGAATTAAGCAGTCTGAGC -3'

Sequencing Primer
(F):5'- CAATATGTGCAGTGGGGAGC -3'
(R):5'- GTCTACCTAGAGCATTCTAGATGG -3'
Posted On2013-11-07