Mutagenetix > Incidental Mutations

Incidental Mutation 'R0882:Gabbr2'

80621

Institutional Source

Beutler Lab

Gene Symbol

Gabbr2

Ensembl Gene

ENSMUSG00000039809

Gene Name

gamma-aminobutyric acid (GABA) B receptor, 2

Synonyms

Gpr51, Gababr2, LOC242425

MMRRC Submission

039049-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.242) question?

Stock #

R0882 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46662305-46991873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46718904 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 38 (I38T)

Ref Sequence

ENSEMBL: ENSMUSP00000146296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107749] [ENSMUST00000205643]

Predicted Effect

probably damaging
Transcript: ENSMUST00000107749
AA Change: I591T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103378
Gene: ENSMUSG00000039809
AA Change: I591T

Domain	Start	End	E-Value	Type
signal peptide	1	40	N/A	INTRINSIC
Pfam:Peripla_BP_6	59	434	1.5e-15	PFAM
Pfam:ANF_receptor	75	429	2e-51	PFAM
Pfam:7tm_3	492	745	6.4e-57	PFAM
PDB:4PAS\|B	778	818	1e-18	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000205643
AA Change: I38T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.2091

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in clonic seizures, hyperactivity, hyperalgesia in response to thermal or mechanical stimuli, increased anxiety, and decreased depression-related behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	A	5: 76,876,283	T174M	probably damaging	Het
Adh1	A	T	3: 138,286,797	I225F	possibly damaging	Het
Agap2	A	G	10: 127,087,450	K691E	unknown	Het
Alcam	T	C	16: 52,253,210	D564G	possibly damaging	Het
Apbb2	T	A	5: 66,400,255	T289S	probably damaging	Het
BC005561	T	C	5: 104,519,009	S466P	probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Cep68	T	C	11: 20,239,393	I540V	probably benign	Het
Ctla4	T	C	1: 60,909,238	V23A	probably benign	Het
Dnah7b	T	A	1: 46,340,132	D3675E	probably benign	Het
Fam209	G	T	2: 172,472,635	V15F	probably benign	Het
Fat3	A	G	9: 16,031,368	V1236A	possibly damaging	Het
Gdpd4	T	C	7: 97,966,298	I110T	probably damaging	Het
Gm4841	C	T	18: 60,269,780	A414T	possibly damaging	Het
Gtf3c4	A	T	2: 28,834,770	Y176N	probably damaging	Het
Hist2h2bb	G	A	3: 96,269,744		probably null	Het
Igsf9b	T	C	9: 27,319,316	Y264H	probably damaging	Het
Itih4	A	T	14: 30,892,274	N394Y	probably damaging	Het
Kmt2c	T	C	5: 25,295,607	T3815A	possibly damaging	Het
Lrwd1	T	C	5: 136,123,400		probably null	Het
Mc3r	A	G	2: 172,249,791	K311R	probably benign	Het
Myb	T	C	10: 21,156,360	T41A	possibly damaging	Het
Nfix	T	C	8: 84,727,925	D201G	probably damaging	Het
Nos1	T	C	5: 117,947,447	V1280A	probably damaging	Het
Olfr160	T	C	9: 37,711,872	M136V	probably benign	Het
Olfr586	A	C	7: 103,122,575	S66A	probably benign	Het
Pcdh15	A	G	10: 74,342,656	T582A	probably damaging	Het
Pcdhb12	C	A	18: 37,437,322	A507E	probably damaging	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Pkp2	C	A	16: 16,269,711	A753E	probably damaging	Het
Plekha3	G	A	2: 76,682,798	V76I	possibly damaging	Het
Pnpla6	T	C	8: 3,517,081	L33P	probably damaging	Het
Pot1b	C	T	17: 55,666,400		probably benign	Het
Prr5l	T	C	2: 101,758,541	E88G	possibly damaging	Het
Prss57	G	A	10: 79,785,865	H97Y	probably damaging	Het
Rttn	C	T	18: 88,973,689	Q131*	probably null	Het
Scaf11	G	T	15: 96,418,295	S1129R	possibly damaging	Het
Slc25a20	T	A	9: 108,681,990	M185K	possibly damaging	Het
Sorbs3	T	A	14: 70,207,572	E19V	probably damaging	Het
Srgap2	A	T	1: 131,289,515	C1020S	probably benign	Het
Tmem109	T	C	19: 10,871,841	R217G	possibly damaging	Het
Trio	A	T	15: 27,732,894	I2967N	probably damaging	Het
Vars2	T	C	17: 35,657,299	E899G	probably benign	Het
Vmn2r109	A	G	17: 20,554,580		probably benign	Het
Vps53	A	G	11: 76,082,659	F170L	probably damaging	Het
Zc2hc1a	G	A	3: 7,526,362	S149N	possibly damaging	Het
Zfp820	A	G	17: 21,823,836		probably benign	Het
Zhx3	A	C	2: 160,780,709	F513V	probably damaging	Het

Other mutations in Gabbr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Gabbr2	APN	4	46787600	missense	probably damaging	1.00
IGL00844:Gabbr2	APN	4	46875711	missense	probably damaging	1.00
IGL01584:Gabbr2	APN	4	46674524	missense	probably damaging	0.97
IGL01684:Gabbr2	APN	4	46736501	missense	probably benign
IGL01884:Gabbr2	APN	4	46875711	missense	probably damaging	1.00
IGL02073:Gabbr2	APN	4	46667547	missense	probably benign	0.00
IGL02376:Gabbr2	APN	4	46684300	missense	probably damaging	1.00
R0194:Gabbr2	UTSW	4	46787565	missense	possibly damaging	0.48
R0627:Gabbr2	UTSW	4	46681223	missense	possibly damaging	0.92
R0685:Gabbr2	UTSW	4	46787521	missense	possibly damaging	0.64
R0781:Gabbr2	UTSW	4	46718838	missense	probably damaging	1.00
R0883:Gabbr2	UTSW	4	46677474	missense	probably benign	0.00
R1004:Gabbr2	UTSW	4	46677544	missense	possibly damaging	0.60
R1078:Gabbr2	UTSW	4	46664833	missense	probably damaging	0.99
R1110:Gabbr2	UTSW	4	46718838	missense	probably damaging	1.00
R1368:Gabbr2	UTSW	4	46674464	missense	probably benign	0.31
R1557:Gabbr2	UTSW	4	46846436	missense	probably damaging	1.00
R1577:Gabbr2	UTSW	4	46684319	missense	probably benign	0.29
R1645:Gabbr2	UTSW	4	46664963	splice site	probably null
R1743:Gabbr2	UTSW	4	46677603	missense	possibly damaging	0.47
R1848:Gabbr2	UTSW	4	46739823	missense	probably benign	0.31
R1997:Gabbr2	UTSW	4	46787502	missense	probably damaging	1.00
R2009:Gabbr2	UTSW	4	46734119	missense	probably damaging	1.00
R4021:Gabbr2	UTSW	4	46846435	missense	probably damaging	1.00
R4719:Gabbr2	UTSW	4	46718797	missense	probably damaging	0.99
R4757:Gabbr2	UTSW	4	46875675	missense	probably damaging	0.98
R4798:Gabbr2	UTSW	4	46991139	missense	possibly damaging	0.92
R5086:Gabbr2	UTSW	4	46724342	missense	probably damaging	1.00
R5176:Gabbr2	UTSW	4	46681208	missense	probably damaging	0.99
R5451:Gabbr2	UTSW	4	46684294	missense	probably benign	0.15
R5510:Gabbr2	UTSW	4	46734113	missense	probably damaging	1.00
R5611:Gabbr2	UTSW	4	46804105	missense	probably damaging	0.98
R6049:Gabbr2	UTSW	4	46787641	missense	probably damaging	1.00
R6089:Gabbr2	UTSW	4	46846448	missense	probably damaging	1.00
R6118:Gabbr2	UTSW	4	46736459	missense	probably damaging	1.00
R6209:Gabbr2	UTSW	4	46804069	missense	probably damaging	1.00
R6212:Gabbr2	UTSW	4	46681189	missense	probably damaging	0.98
R6717:Gabbr2	UTSW	4	46787574	missense	possibly damaging	0.50
R7339:Gabbr2	UTSW	4	46846340	missense	probably benign	0.01
R7479:Gabbr2	UTSW	4	46681166	missense	probably damaging	0.98
R7695:Gabbr2	UTSW	4	46875687	missense	probably damaging	1.00
R7808:Gabbr2	UTSW	4	46875744	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- ATCGGTGCTTCCCCAATTATGACAG -3'
(R):5'- CCATTGAGCAGAGACTAAACGTGGC -3'

Sequencing Primer
(F):5'- CAATTATGACAGTACACTCCTTCAAG -3'
(R):5'- GGCCAGATTTCAACAAGTTGC -3'

Posted On

2013-11-07