Incidental Mutation 'R0928:En2'
ID 80632
Institutional Source Beutler Lab
Gene Symbol En2
Ensembl Gene ENSMUSG00000039095
Gene Name engrailed 2
Synonyms En-2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock # R0928 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 28165694-28172166 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 28170331 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 291 (K291*)
Ref Sequence ENSEMBL: ENSMUSP00000036761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036177]
AlphaFold P09066
Predicted Effect probably null
Transcript: ENSMUST00000036177
AA Change: K291*
SMART Domains Protein: ENSMUSP00000036761
Gene: ENSMUSG00000039095
AA Change: K291*

DomainStartEndE-ValueType
low complexity region 21 39 N/A INTRINSIC
low complexity region 81 112 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
HOX 235 297 1.72e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199117
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 93.0%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeobox-containing genes are thought to have a role in controlling development. In Drosophila, the 'engrailed' (en) gene plays an important role during development in segmentation, where it is required for the formation of posterior compartments. Different mutations in the mouse homologs, En1 and En2, produced different developmental defects that frequently are lethal. The human engrailed homologs 1 and 2 encode homeodomain-containing proteins and have been implicated in the control of pattern formation during development of the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: This locus affects anterior-posterior cerebellar patterning. Homozygous null mutants show altered foliation pattern and perform poorly in motor learning (rotarod) tests. Heterozygotes test intermediate on rotarod. Hypomorphs show no phenotypic effects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,582 D745G possibly damaging Het
4931406P16Rik A T 7: 34,248,246 probably null Het
Abca12 T A 1: 71,349,174 D179V probably benign Het
Abcc1 T C 16: 14,389,985 probably null Het
Adad1 G A 3: 37,076,740 probably null Het
Apobec4 T C 1: 152,756,277 Y19H probably damaging Het
Bco2 T A 9: 50,545,931 T104S probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
Ccdc144b A C 3: 36,025,366 N258K possibly damaging Het
Ccs T C 19: 4,825,960 E184G probably damaging Het
Cfap70 T G 14: 20,443,919 K97N probably damaging Het
Daam2 T C 17: 49,488,227 I313V probably benign Het
Dach1 T C 14: 97,915,832 S467G probably damaging Het
Dnah11 A G 12: 118,045,562 S2122P probably damaging Het
Dnah3 T A 7: 120,030,051 D1427V probably damaging Het
Dnaic1 T C 4: 41,602,566 F97L possibly damaging Het
Dsc1 A T 18: 20,110,249 probably null Het
Eps15 T C 4: 109,312,963 V154A possibly damaging Het
Etnk1 A G 6: 143,184,703 I183V probably benign Het
Fcrlb A T 1: 170,907,940 V255D possibly damaging Het
Fry A T 5: 150,437,084 E52V probably damaging Het
Gm8251 C A 1: 44,057,228 S1570I possibly damaging Het
Gtf2h4 T C 17: 35,670,885 Y152C probably damaging Het
Hao1 C A 2: 134,505,616 L256F possibly damaging Het
Helz T A 11: 107,626,693 I685K probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Izumo2 A T 7: 44,715,423 I171F possibly damaging Het
Krt83 C A 15: 101,491,280 C57F probably benign Het
Mapkbp1 A G 2: 120,015,368 H400R probably benign Het
Megf6 T A 4: 154,177,047 V43E probably damaging Het
Mut T C 17: 40,937,283 I67T probably benign Het
Ninl A T 2: 150,963,475 V396E probably damaging Het
Nvl A T 1: 181,093,902 V844E probably benign Het
Olfr11 C T 13: 21,638,956 C189Y probably damaging Het
P2rx3 A T 2: 85,035,298 M1K probably null Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Ppp3r2 C A 4: 49,681,439 probably null Het
Prmt6 C T 3: 110,250,682 G97D probably damaging Het
Prmt9 T C 8: 77,581,176 V823A probably damaging Het
Skint11 C A 4: 114,244,601 D79E possibly damaging Het
Slc17a8 T A 10: 89,598,683 H194L probably damaging Het
Slco6c1 T A 1: 97,104,848 I293F possibly damaging Het
Tcl1b4 A T 12: 105,202,606 H43L probably benign Het
Tm9sf1 T C 14: 55,636,457 D528G probably damaging Het
Tpbpb C T 13: 60,902,175 V47I probably benign Het
Ttc37 T G 13: 76,113,592 L142W probably damaging Het
Ttn G T 2: 76,907,532 probably benign Het
Usp28 T G 9: 49,030,891 S341A possibly damaging Het
Vwa5a T C 9: 38,728,007 Y345H probably damaging Het
Wdr11 C A 7: 129,606,653 D377E probably damaging Het
Zer1 A G 2: 30,101,763 probably null Het
Other mutations in En2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02943:En2 APN 5 28166526 utr 5 prime probably benign
R2083:En2 UTSW 5 28167073 missense probably damaging 0.98
R2356:En2 UTSW 5 28166332 start gained probably benign
R2762:En2 UTSW 5 28170421 missense probably damaging 0.99
R5470:En2 UTSW 5 28166924 missense probably benign 0.03
R5760:En2 UTSW 5 28166999 missense probably benign 0.41
R6762:En2 UTSW 5 28170353 missense possibly damaging 0.65
R7640:En2 UTSW 5 28170166 nonsense probably null
R7687:En2 UTSW 5 28170289 missense probably damaging 1.00
R7827:En2 UTSW 5 28166596 missense probably benign
R8409:En2 UTSW 5 28166884 missense probably benign
R8861:En2 UTSW 5 28166735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCAACACTTGTATGGCCTTG -3'
(R):5'- ATTGTTTCTCGCGGCCCTAGAC -3'

Sequencing Primer
(F):5'- TTGTGGATAAGTAGCTAGACTCCAG -3'
(R):5'- AATGGTTGTACAGGCCCTGTG -3'
Posted On 2013-11-07