Incidental Mutation 'R0928:Etnk1'
ID80638
Institutional Source Beutler Lab
Gene Symbol Etnk1
Ensembl Gene ENSMUSG00000030275
Gene Nameethanolamine kinase 1
SynonymsEKI1, D6Ertd3e, 4930555L11Rik, 1110061E11Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0928 (G1)
Quality Score150
Status Not validated
Chromosome6
Chromosomal Location143167221-143232307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143184703 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 183 (I183V)
Ref Sequence ENSEMBL: ENSMUSP00000145041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032413] [ENSMUST00000204947] [ENSMUST00000205256]
Predicted Effect probably benign
Transcript: ENSMUST00000032413
AA Change: I183V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032413
Gene: ENSMUSG00000030275
AA Change: I183V

DomainStartEndE-ValueType
Pfam:APH 50 296 1.8e-16 PFAM
Pfam:Choline_kinase 71 276 2.8e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203341
Predicted Effect probably benign
Transcript: ENSMUST00000204947
AA Change: I183V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000145041
Gene: ENSMUSG00000030275
AA Change: I183V

DomainStartEndE-ValueType
Pfam:APH 50 296 2.3e-14 PFAM
Pfam:Choline_kinase 71 276 2.7e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205256
AA Change: I183V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144903
Gene: ENSMUSG00000030275
AA Change: I183V

DomainStartEndE-ValueType
Pfam:APH 50 296 1.7e-14 PFAM
Pfam:Choline_kinase 71 276 2.1e-61 PFAM
Pfam:EcKinase 184 260 3e-4 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 93.0%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ethanolamine kinase, which functions in the first committed step of the phosphatidylethanolamine synthesis pathway. This cytosolic enzyme is specific for ethanolamine and exhibits negligible kinase activity on choline. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,582 D745G possibly damaging Het
4931406P16Rik A T 7: 34,248,246 probably null Het
Abca12 T A 1: 71,349,174 D179V probably benign Het
Abcc1 T C 16: 14,389,985 probably null Het
Adad1 G A 3: 37,076,740 probably null Het
Apobec4 T C 1: 152,756,277 Y19H probably damaging Het
Bco2 T A 9: 50,545,931 T104S probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
Ccdc144b A C 3: 36,025,366 N258K possibly damaging Het
Ccs T C 19: 4,825,960 E184G probably damaging Het
Cfap70 T G 14: 20,443,919 K97N probably damaging Het
Daam2 T C 17: 49,488,227 I313V probably benign Het
Dach1 T C 14: 97,915,832 S467G probably damaging Het
Dnah11 A G 12: 118,045,562 S2122P probably damaging Het
Dnah3 T A 7: 120,030,051 D1427V probably damaging Het
Dnaic1 T C 4: 41,602,566 F97L possibly damaging Het
Dsc1 A T 18: 20,110,249 probably null Het
En2 A T 5: 28,170,331 K291* probably null Het
Eps15 T C 4: 109,312,963 V154A possibly damaging Het
Fcrlb A T 1: 170,907,940 V255D possibly damaging Het
Fry A T 5: 150,437,084 E52V probably damaging Het
Gm8251 C A 1: 44,057,228 S1570I possibly damaging Het
Gtf2h4 T C 17: 35,670,885 Y152C probably damaging Het
Hao1 C A 2: 134,505,616 L256F possibly damaging Het
Helz T A 11: 107,626,693 I685K probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Izumo2 A T 7: 44,715,423 I171F possibly damaging Het
Krt83 C A 15: 101,491,280 C57F probably benign Het
Mapkbp1 A G 2: 120,015,368 H400R probably benign Het
Megf6 T A 4: 154,177,047 V43E probably damaging Het
Mut T C 17: 40,937,283 I67T probably benign Het
Ninl A T 2: 150,963,475 V396E probably damaging Het
Nvl A T 1: 181,093,902 V844E probably benign Het
Olfr11 C T 13: 21,638,956 C189Y probably damaging Het
P2rx3 A T 2: 85,035,298 M1K probably null Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Ppp3r2 C A 4: 49,681,439 probably null Het
Prmt6 C T 3: 110,250,682 G97D probably damaging Het
Prmt9 T C 8: 77,581,176 V823A probably damaging Het
Skint11 C A 4: 114,244,601 D79E possibly damaging Het
Slc17a8 T A 10: 89,598,683 H194L probably damaging Het
Slco6c1 T A 1: 97,104,848 I293F possibly damaging Het
Tcl1b4 A T 12: 105,202,606 H43L probably benign Het
Tm9sf1 T C 14: 55,636,457 D528G probably damaging Het
Tpbpb C T 13: 60,902,175 V47I probably benign Het
Ttc37 T G 13: 76,113,592 L142W probably damaging Het
Ttn G T 2: 76,907,532 probably benign Het
Usp28 T G 9: 49,030,891 S341A possibly damaging Het
Vwa5a T C 9: 38,728,007 Y345H probably damaging Het
Wdr11 C A 7: 129,606,653 D377E probably damaging Het
Zer1 A G 2: 30,101,763 probably null Het
Other mutations in Etnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Etnk1 APN 6 143180666 missense probably damaging 1.00
R0415:Etnk1 UTSW 6 143180774 missense probably damaging 1.00
R1542:Etnk1 UTSW 6 143180641 missense probably benign 0.00
R4648:Etnk1 UTSW 6 143195274 missense probably damaging 1.00
R4744:Etnk1 UTSW 6 143186593 missense probably damaging 1.00
R4823:Etnk1 UTSW 6 143167638 critical splice donor site probably null
R5039:Etnk1 UTSW 6 143195317 critical splice donor site probably null
R5909:Etnk1 UTSW 6 143197438 missense probably benign 0.02
R6207:Etnk1 UTSW 6 143180798 missense probably damaging 0.99
R6743:Etnk1 UTSW 6 143180617 missense possibly damaging 0.68
R7009:Etnk1 UTSW 6 143203154 critical splice donor site probably null
X0026:Etnk1 UTSW 6 143180726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCTAACAGTGACACAGTGAGAATC -3'
(R):5'- CCTCTAGACCTTTACGGTAATTGGTGC -3'

Sequencing Primer
(F):5'- GGCTAATAGCTCGTCAGCTT -3'
(R):5'- AGGAATGCACACCAGCACTA -3'
Posted On2013-11-07