Mutagenetix > Incidental Mutation

Incidental Mutation 'R0928:Bnc1'

80644

Institutional Source

Beutler Lab

Gene Symbol

Bnc1

Ensembl Gene

ENSMUSG00000025105

Gene Name

basonuclin 1

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0928 (G1)

Quality Score

144

Status

Not validated

Chromosome

Chromosomal Location

81966672-81992292 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81973502 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 659 (V659A)

Ref Sequence

ENSEMBL: ENSMUSP00000026096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026096]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000026096
AA Change: V659A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000026096
Gene: ENSMUSG00000025105
AA Change: V659A

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
low complexity region	313	327	N/A	INTRINSIC
ZnF_C2H2	354	377	1.43e-1	SMART
ZnF_C2H2	382	411	6.75e0	SMART
low complexity region	505	514	N/A	INTRINSIC
low complexity region	541	554	N/A	INTRINSIC
low complexity region	570	583	N/A	INTRINSIC
low complexity region	619	633	N/A	INTRINSIC
ZnF_C2H2	716	739	1.47e-3	SMART
ZnF_C2H2	744	771	5.62e0	SMART
low complexity region	855	876	N/A	INTRINSIC
ZnF_C2H2	924	947	3.11e-2	SMART
ZnF_C2H2	952	979	8.09e-1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.1%
10x: 93.0%
20x: 75.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein present in the basal cell layer of the epidermis and in hair follicles. It is also found in abundance in the germ cells of testis and ovary. This protein is thought to play a regulatory role in keratinocyte proliferation and it may also be a regulator for rRNA transcription. Alternative splicing of this gene results in multiple transcript variants, and multiple polyadenylation sites are indicated.[provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit thinning and delayed wound healing of the corneal epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	C	1: 37,624,582	D745G	possibly damaging	Het
4931406P16Rik	A	T	7: 34,248,246		probably null	Het
Abca12	T	A	1: 71,349,174	D179V	probably benign	Het
Abcc1	T	C	16: 14,389,985		probably null	Het
Adad1	G	A	3: 37,076,740		probably null	Het
Apobec4	T	C	1: 152,756,277	Y19H	probably damaging	Het
Bco2	T	A	9: 50,545,931	T104S	probably damaging	Het
Ccdc144b	A	C	3: 36,025,366	N258K	possibly damaging	Het
Ccs	T	C	19: 4,825,960	E184G	probably damaging	Het
Cfap70	T	G	14: 20,443,919	K97N	probably damaging	Het
Daam2	T	C	17: 49,488,227	I313V	probably benign	Het
Dach1	T	C	14: 97,915,832	S467G	probably damaging	Het
Dnah11	A	G	12: 118,045,562	S2122P	probably damaging	Het
Dnah3	T	A	7: 120,030,051	D1427V	probably damaging	Het
Dnaic1	T	C	4: 41,602,566	F97L	possibly damaging	Het
Dsc1	A	T	18: 20,110,249		probably null	Het
En2	A	T	5: 28,170,331	K291*	probably null	Het
Eps15	T	C	4: 109,312,963	V154A	possibly damaging	Het
Etnk1	A	G	6: 143,184,703	I183V	probably benign	Het
Fcrlb	A	T	1: 170,907,940	V255D	possibly damaging	Het
Fry	A	T	5: 150,437,084	E52V	probably damaging	Het
Gm8251	C	A	1: 44,057,228	S1570I	possibly damaging	Het
Gtf2h4	T	C	17: 35,670,885	Y152C	probably damaging	Het
Hao1	C	A	2: 134,505,616	L256F	possibly damaging	Het
Helz	T	A	11: 107,626,693	I685K	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Izumo2	A	T	7: 44,715,423	I171F	possibly damaging	Het
Krt83	C	A	15: 101,491,280	C57F	probably benign	Het
Mapkbp1	A	G	2: 120,015,368	H400R	probably benign	Het
Megf6	T	A	4: 154,177,047	V43E	probably damaging	Het
Mut	T	C	17: 40,937,283	I67T	probably benign	Het
Ninl	A	T	2: 150,963,475	V396E	probably damaging	Het
Nvl	A	T	1: 181,093,902	V844E	probably benign	Het
Olfr11	C	T	13: 21,638,956	C189Y	probably damaging	Het
P2rx3	A	T	2: 85,035,298	M1K	probably null	Het
Pabpn1l	T	C	8: 122,622,619	T20A	probably benign	Het
Ppp3r2	C	A	4: 49,681,439		probably null	Het
Prmt6	C	T	3: 110,250,682	G97D	probably damaging	Het
Prmt9	T	C	8: 77,581,176	V823A	probably damaging	Het
Skint11	C	A	4: 114,244,601	D79E	possibly damaging	Het
Slc17a8	T	A	10: 89,598,683	H194L	probably damaging	Het
Slco6c1	T	A	1: 97,104,848	I293F	possibly damaging	Het
Tcl1b4	A	T	12: 105,202,606	H43L	probably benign	Het
Tm9sf1	T	C	14: 55,636,457	D528G	probably damaging	Het
Tpbpb	C	T	13: 60,902,175	V47I	probably benign	Het
Ttc37	T	G	13: 76,113,592	L142W	probably damaging	Het
Ttn	G	T	2: 76,907,532		probably benign	Het
Usp28	T	G	9: 49,030,891	S341A	possibly damaging	Het
Vwa5a	T	C	9: 38,728,007	Y345H	probably damaging	Het
Wdr11	C	A	7: 129,606,653	D377E	probably damaging	Het
Zer1	A	G	2: 30,101,763		probably null	Het

Other mutations in Bnc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Bnc1	APN	7	81973707	nonsense	probably null
IGL01293:Bnc1	APN	7	81974489	missense	probably damaging	0.99
IGL02064:Bnc1	APN	7	81973503	missense	probably benign	0.00
IGL02529:Bnc1	APN	7	81977368	missense	probably damaging	0.99
IGL03087:Bnc1	APN	7	81974642	missense	possibly damaging	0.86
R0088:Bnc1	UTSW	7	81978498	missense	possibly damaging	0.52
R0312:Bnc1	UTSW	7	81977324	missense	possibly damaging	0.95
R0631:Bnc1	UTSW	7	81974366	missense	probably damaging	0.99
R0924:Bnc1	UTSW	7	81978408	splice site	probably benign
R1967:Bnc1	UTSW	7	81973636	missense	probably benign	0.03
R2243:Bnc1	UTSW	7	81974073	missense	possibly damaging	0.59
R2404:Bnc1	UTSW	7	81968715	missense	probably benign	0.08
R4079:Bnc1	UTSW	7	81973760	missense	probably damaging	0.99
R4416:Bnc1	UTSW	7	81968960	missense	probably benign
R5038:Bnc1	UTSW	7	81968714	missense	probably damaging	1.00
R5055:Bnc1	UTSW	7	81974415	missense	probably damaging	0.99
R7083:Bnc1	UTSW	7	81973310	missense	probably damaging	1.00
R7117:Bnc1	UTSW	7	81973361	missense	possibly damaging	0.92
R7151:Bnc1	UTSW	7	81973307	missense	possibly damaging	0.71
R7386:Bnc1	UTSW	7	81974492	missense	possibly damaging	0.81
R7950:Bnc1	UTSW	7	81973502	missense	probably benign
R8355:Bnc1	UTSW	7	81968876	missense	probably damaging	0.97
R8773:Bnc1	UTSW	7	81973971	missense	probably damaging	1.00
R9083:Bnc1	UTSW	7	81974898	missense	probably benign
Z1176:Bnc1	UTSW	7	81974542	missense	probably damaging	0.97
Z1177:Bnc1	UTSW	7	81968470	missense	probably damaging	0.97
Z1186:Bnc1	UTSW	7	81973259	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCAGATGTCACACTGGAAGCAAG -3'
(R):5'- CTGAGGAGCAGCATACACAGCTAAG -3'

Sequencing Primer
(F):5'- GGAAGCAAGCTTCTTCCTTCTG -3'
(R):5'- TTAGAGGAGCCTCTTCCACAAG -3'

Posted On

2013-11-07