Incidental Mutation 'R0882:Myb'
ID80653
Institutional Source Beutler Lab
Gene Symbol Myb
Ensembl Gene ENSMUSG00000019982
Gene Namemyeloblastosis oncogene
Synonymsc-myb
MMRRC Submission 039049-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0882 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location21124935-21160984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21156360 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 41 (T41A)
Ref Sequence ENSEMBL: ENSMUSP00000020158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020158] [ENSMUST00000188495]
PDB Structure
CRYSTAL STRUCTURE OF C-MYB R1 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF C-MYB R2R3 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF C-MYB R2 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF C-MYB R2 V103L MUTANT [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF TERNARY PROTEIN-DNA COMPLEX1 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF TERNARY PROTEIN-DNA COMPLEX2 [X-RAY DIFFRACTION]
STRUCTURE OF MYB TRANSFORMING PROTEIN, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
STRUCTURE OF MYB TRANSFORMING PROTEIN, NMR, 20 STRUCTURES [SOLUTION NMR]
MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 1 [SOLUTION NMR]
MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 1 [SOLUTION NMR]
>> 8 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000020158
AA Change: T41A

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020158
Gene: ENSMUSG00000019982
AA Change: T41A

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
SANT 39 88 9.52e-20 SMART
SANT 91 140 2.04e-19 SMART
SANT 143 191 1.75e-18 SMART
low complexity region 227 239 N/A INTRINSIC
Pfam:LMSTEN 267 313 4e-29 PFAM
Pfam:Cmyb_C 399 559 1.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186446
Predicted Effect probably benign
Transcript: ENSMUST00000188495
AA Change: T41A

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139699
Gene: ENSMUSG00000019982
AA Change: T41A

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
SANT 39 88 9.52e-20 SMART
SANT 91 140 2.04e-19 SMART
SANT 143 191 1.75e-18 SMART
low complexity region 227 239 N/A INTRINSIC
Pfam:LMSTEN 266 313 3.6e-32 PFAM
low complexity region 409 421 N/A INTRINSIC
Pfam:Cmyb_C 516 682 8.5e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214539
Meta Mutation Damage Score 0.1776 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with three HTH DNA-binding domains that functions as a transcription regulator. This protein plays an essential role in the regulation of hematopoiesis. This gene may be aberrently expressed or rearranged or undergo translocation in leukemias and lymphomas, and is considered to be an oncogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for deficient alleles of this gene display severe hematopoietic abnormalities. Red and white blood cells and platelets are all affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Adh1 A T 3: 138,286,797 I225F possibly damaging Het
Agap2 A G 10: 127,087,450 K691E unknown Het
Alcam T C 16: 52,253,210 D564G possibly damaging Het
Apbb2 T A 5: 66,400,255 T289S probably damaging Het
BC005561 T C 5: 104,519,009 S466P probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cep68 T C 11: 20,239,393 I540V probably benign Het
Ctla4 T C 1: 60,909,238 V23A probably benign Het
Dnah7b T A 1: 46,340,132 D3675E probably benign Het
Fam209 G T 2: 172,472,635 V15F probably benign Het
Fat3 A G 9: 16,031,368 V1236A possibly damaging Het
Gabbr2 A G 4: 46,718,904 I38T probably damaging Het
Gdpd4 T C 7: 97,966,298 I110T probably damaging Het
Gm4841 C T 18: 60,269,780 A414T possibly damaging Het
Gtf3c4 A T 2: 28,834,770 Y176N probably damaging Het
Hist2h2bb G A 3: 96,269,744 probably null Het
Igsf9b T C 9: 27,319,316 Y264H probably damaging Het
Itih4 A T 14: 30,892,274 N394Y probably damaging Het
Kmt2c T C 5: 25,295,607 T3815A possibly damaging Het
Lrwd1 T C 5: 136,123,400 probably null Het
Mc3r A G 2: 172,249,791 K311R probably benign Het
Nfix T C 8: 84,727,925 D201G probably damaging Het
Nos1 T C 5: 117,947,447 V1280A probably damaging Het
Olfr160 T C 9: 37,711,872 M136V probably benign Het
Olfr586 A C 7: 103,122,575 S66A probably benign Het
Pcdh15 A G 10: 74,342,656 T582A probably damaging Het
Pcdhb12 C A 18: 37,437,322 A507E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pkp2 C A 16: 16,269,711 A753E probably damaging Het
Plekha3 G A 2: 76,682,798 V76I possibly damaging Het
Pnpla6 T C 8: 3,517,081 L33P probably damaging Het
Pot1b C T 17: 55,666,400 probably benign Het
Prr5l T C 2: 101,758,541 E88G possibly damaging Het
Prss57 G A 10: 79,785,865 H97Y probably damaging Het
Rttn C T 18: 88,973,689 Q131* probably null Het
Scaf11 G T 15: 96,418,295 S1129R possibly damaging Het
Slc25a20 T A 9: 108,681,990 M185K possibly damaging Het
Sorbs3 T A 14: 70,207,572 E19V probably damaging Het
Srgap2 A T 1: 131,289,515 C1020S probably benign Het
Tmem109 T C 19: 10,871,841 R217G possibly damaging Het
Trio A T 15: 27,732,894 I2967N probably damaging Het
Vars2 T C 17: 35,657,299 E899G probably benign Het
Vmn2r109 A G 17: 20,554,580 probably benign Het
Vps53 A G 11: 76,082,659 F170L probably damaging Het
Zc2hc1a G A 3: 7,526,362 S149N possibly damaging Het
Zfp820 A G 17: 21,823,836 probably benign Het
Zhx3 A C 2: 160,780,709 F513V probably damaging Het
Other mutations in Myb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Myb APN 10 21141826 missense probably damaging 0.99
IGL00707:Myb APN 10 21148384 missense probably damaging 1.00
IGL00796:Myb APN 10 21141799 missense probably benign 0.00
IGL01012:Myb APN 10 21146260 missense probably benign 0.03
IGL01082:Myb APN 10 21152944 missense probably damaging 1.00
IGL01365:Myb APN 10 21152502 missense probably benign 0.31
IGL01906:Myb APN 10 21152634 missense probably damaging 1.00
IGL02560:Myb APN 10 21152448 missense probably damaging 1.00
Huang_river UTSW 10 21152617 missense probably damaging 1.00
PIT4495001:Myb UTSW 10 21152622 missense probably damaging 0.98
R0385:Myb UTSW 10 21154712 missense possibly damaging 0.73
R0442:Myb UTSW 10 21126196 missense probably benign 0.05
R0759:Myb UTSW 10 21145028 missense probably benign 0.01
R0920:Myb UTSW 10 21126234 missense possibly damaging 0.80
R1401:Myb UTSW 10 21152945 missense probably damaging 1.00
R1651:Myb UTSW 10 21126198 missense probably damaging 1.00
R1752:Myb UTSW 10 21156437 missense possibly damaging 0.89
R1879:Myb UTSW 10 21141977 missense probably benign 0.24
R1971:Myb UTSW 10 21140656 missense probably benign 0.00
R4355:Myb UTSW 10 21152617 missense probably damaging 1.00
R4611:Myb UTSW 10 21145324 missense probably damaging 1.00
R4650:Myb UTSW 10 21152941 missense probably damaging 1.00
R4888:Myb UTSW 10 21126238 missense probably benign 0.01
R5121:Myb UTSW 10 21126238 missense probably benign 0.01
R5922:Myb UTSW 10 21152927 missense probably damaging 1.00
R5955:Myb UTSW 10 21152499 missense probably damaging 1.00
R6116:Myb UTSW 10 21154754 missense probably damaging 1.00
R6150:Myb UTSW 10 21141769 missense probably damaging 1.00
R6207:Myb UTSW 10 21145322 missense probably benign
R6656:Myb UTSW 10 21152945 missense probably damaging 1.00
R6801:Myb UTSW 10 21144966 splice site probably null
R6824:Myb UTSW 10 21145120 missense probably benign 0.00
R6884:Myb UTSW 10 21152532 missense probably damaging 1.00
R6977:Myb UTSW 10 21152652 missense probably damaging 0.96
R7562:Myb UTSW 10 21141754 splice site probably null
R7651:Myb UTSW 10 21156374 missense probably damaging 1.00
R7747:Myb UTSW 10 21156425 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTGGGAGAGAAGAACACGAGCATTC -3'
(R):5'- AGTAACAGGTTCAAACATGCAGAGCAA -3'

Sequencing Primer
(F):5'- CACATGTAGCTTAGCCGAGA -3'
(R):5'- CCAGAATGCAGAAAACCTCATTG -3'
Posted On2013-11-07