Incidental Mutation 'R0928:Olfr11'
ID80680
Institutional Source Beutler Lab
Gene Symbol Olfr11
Ensembl Gene ENSMUSG00000036658
Gene Nameolfactory receptor 11
SynonymsGA_x6K02T2QHY8-11597382-11598323, MOR256-11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R0928 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21636623-21642518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21638956 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 189 (C189Y)
Ref Sequence ENSEMBL: ENSMUSP00000146091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043081] [ENSMUST00000205631]
Predicted Effect probably damaging
Transcript: ENSMUST00000043081
AA Change: C189Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043099
Gene: ENSMUSG00000036658
AA Change: C189Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 4.9e-51 PFAM
Pfam:7tm_1 41 290 7.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205631
AA Change: C189Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 93.0%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,582 D745G possibly damaging Het
4931406P16Rik A T 7: 34,248,246 probably null Het
Abca12 T A 1: 71,349,174 D179V probably benign Het
Abcc1 T C 16: 14,389,985 probably null Het
Adad1 G A 3: 37,076,740 probably null Het
Apobec4 T C 1: 152,756,277 Y19H probably damaging Het
Bco2 T A 9: 50,545,931 T104S probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
Ccdc144b A C 3: 36,025,366 N258K possibly damaging Het
Ccs T C 19: 4,825,960 E184G probably damaging Het
Cfap70 T G 14: 20,443,919 K97N probably damaging Het
Daam2 T C 17: 49,488,227 I313V probably benign Het
Dach1 T C 14: 97,915,832 S467G probably damaging Het
Dnah11 A G 12: 118,045,562 S2122P probably damaging Het
Dnah3 T A 7: 120,030,051 D1427V probably damaging Het
Dnaic1 T C 4: 41,602,566 F97L possibly damaging Het
Dsc1 A T 18: 20,110,249 probably null Het
En2 A T 5: 28,170,331 K291* probably null Het
Eps15 T C 4: 109,312,963 V154A possibly damaging Het
Etnk1 A G 6: 143,184,703 I183V probably benign Het
Fcrlb A T 1: 170,907,940 V255D possibly damaging Het
Fry A T 5: 150,437,084 E52V probably damaging Het
Gm8251 C A 1: 44,057,228 S1570I possibly damaging Het
Gtf2h4 T C 17: 35,670,885 Y152C probably damaging Het
Hao1 C A 2: 134,505,616 L256F possibly damaging Het
Helz T A 11: 107,626,693 I685K probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Izumo2 A T 7: 44,715,423 I171F possibly damaging Het
Krt83 C A 15: 101,491,280 C57F probably benign Het
Mapkbp1 A G 2: 120,015,368 H400R probably benign Het
Megf6 T A 4: 154,177,047 V43E probably damaging Het
Mut T C 17: 40,937,283 I67T probably benign Het
Ninl A T 2: 150,963,475 V396E probably damaging Het
Nvl A T 1: 181,093,902 V844E probably benign Het
P2rx3 A T 2: 85,035,298 M1K probably null Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Ppp3r2 C A 4: 49,681,439 probably null Het
Prmt6 C T 3: 110,250,682 G97D probably damaging Het
Prmt9 T C 8: 77,581,176 V823A probably damaging Het
Skint11 C A 4: 114,244,601 D79E possibly damaging Het
Slc17a8 T A 10: 89,598,683 H194L probably damaging Het
Slco6c1 T A 1: 97,104,848 I293F possibly damaging Het
Tcl1b4 A T 12: 105,202,606 H43L probably benign Het
Tm9sf1 T C 14: 55,636,457 D528G probably damaging Het
Tpbpb C T 13: 60,902,175 V47I probably benign Het
Ttc37 T G 13: 76,113,592 L142W probably damaging Het
Ttn G T 2: 76,907,532 probably benign Het
Usp28 T G 9: 49,030,891 S341A possibly damaging Het
Vwa5a T C 9: 38,728,007 Y345H probably damaging Het
Wdr11 C A 7: 129,606,653 D377E probably damaging Het
Zer1 A G 2: 30,101,763 probably null Het
Other mutations in Olfr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02513:Olfr11 APN 13 21639340 missense probably damaging 1.00
R0513:Olfr11 UTSW 13 21638949 missense probably benign 0.26
R1440:Olfr11 UTSW 13 21639390 missense probably benign 0.11
R1673:Olfr11 UTSW 13 21639044 missense probably damaging 1.00
R1705:Olfr11 UTSW 13 21639161 missense probably damaging 1.00
R2080:Olfr11 UTSW 13 21639436 missense probably damaging 0.99
R2187:Olfr11 UTSW 13 21639385 missense probably damaging 0.99
R2283:Olfr11 UTSW 13 21639020 missense probably damaging 1.00
R2340:Olfr11 UTSW 13 21638587 missense probably benign 0.03
R3690:Olfr11 UTSW 13 21639338 missense probably damaging 1.00
R4108:Olfr11 UTSW 13 21638782 missense probably damaging 1.00
R4739:Olfr11 UTSW 13 21639170 missense possibly damaging 0.90
R4740:Olfr11 UTSW 13 21639170 missense possibly damaging 0.90
R5335:Olfr11 UTSW 13 21638779 missense probably damaging 1.00
R5790:Olfr11 UTSW 13 21638876 missense probably benign
R6320:Olfr11 UTSW 13 21639248 missense probably damaging 1.00
R7406:Olfr11 UTSW 13 21639146 missense probably benign 0.16
R7508:Olfr11 UTSW 13 21638609 missense probably benign 0.19
R8054:Olfr11 UTSW 13 21638949 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GATGAGAGCTACAGGTCCCAAACG -3'
(R):5'- GTGTGTTCTACTGCCAGTCATGTCC -3'

Sequencing Primer
(F):5'- GTCCCAAACGCCTTTTGACG -3'
(R):5'- CAGTCATGTCCTTCGACAGG -3'
Posted On2013-11-07