Incidental Mutation 'R0882:Pot1b'
ID80683
Institutional Source Beutler Lab
Gene Symbol Pot1b
Ensembl Gene ENSMUSG00000024174
Gene Nameprotection of telomeres 1B
Synonyms
MMRRC Submission 039049-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0882 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location55652025-55712628 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 55666400 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086876]
Predicted Effect probably benign
Transcript: ENSMUST00000086876
SMART Domains Protein: ENSMUSP00000084089
Gene: ENSMUSG00000024174

DomainStartEndE-ValueType
Telo_bind 11 141 1.74e-51 SMART
Pfam:POT1PC 152 299 7.9e-40 PFAM
low complexity region 313 333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157874
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for one null mutation display male infertility with age, male germ cell apoptosis, hyperpigmentation, increased apoptosis in intestinal crypts, and decreased body size. Mice homozygous for a transgenic gene disruption exhibit neonatal lethality with possible stem cell defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Adh1 A T 3: 138,286,797 I225F possibly damaging Het
Agap2 A G 10: 127,087,450 K691E unknown Het
Alcam T C 16: 52,253,210 D564G possibly damaging Het
Apbb2 T A 5: 66,400,255 T289S probably damaging Het
BC005561 T C 5: 104,519,009 S466P probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cep68 T C 11: 20,239,393 I540V probably benign Het
Ctla4 T C 1: 60,909,238 V23A probably benign Het
Dnah7b T A 1: 46,340,132 D3675E probably benign Het
Fam209 G T 2: 172,472,635 V15F probably benign Het
Fat3 A G 9: 16,031,368 V1236A possibly damaging Het
Gabbr2 A G 4: 46,718,904 I38T probably damaging Het
Gdpd4 T C 7: 97,966,298 I110T probably damaging Het
Gm4841 C T 18: 60,269,780 A414T possibly damaging Het
Gtf3c4 A T 2: 28,834,770 Y176N probably damaging Het
Hist2h2bb G A 3: 96,269,744 probably null Het
Igsf9b T C 9: 27,319,316 Y264H probably damaging Het
Itih4 A T 14: 30,892,274 N394Y probably damaging Het
Kmt2c T C 5: 25,295,607 T3815A possibly damaging Het
Lrwd1 T C 5: 136,123,400 probably null Het
Mc3r A G 2: 172,249,791 K311R probably benign Het
Myb T C 10: 21,156,360 T41A possibly damaging Het
Nfix T C 8: 84,727,925 D201G probably damaging Het
Nos1 T C 5: 117,947,447 V1280A probably damaging Het
Olfr160 T C 9: 37,711,872 M136V probably benign Het
Olfr586 A C 7: 103,122,575 S66A probably benign Het
Pcdh15 A G 10: 74,342,656 T582A probably damaging Het
Pcdhb12 C A 18: 37,437,322 A507E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pkp2 C A 16: 16,269,711 A753E probably damaging Het
Plekha3 G A 2: 76,682,798 V76I possibly damaging Het
Pnpla6 T C 8: 3,517,081 L33P probably damaging Het
Prr5l T C 2: 101,758,541 E88G possibly damaging Het
Prss57 G A 10: 79,785,865 H97Y probably damaging Het
Rttn C T 18: 88,973,689 Q131* probably null Het
Scaf11 G T 15: 96,418,295 S1129R possibly damaging Het
Slc25a20 T A 9: 108,681,990 M185K possibly damaging Het
Sorbs3 T A 14: 70,207,572 E19V probably damaging Het
Srgap2 A T 1: 131,289,515 C1020S probably benign Het
Tmem109 T C 19: 10,871,841 R217G possibly damaging Het
Trio A T 15: 27,732,894 I2967N probably damaging Het
Vars2 T C 17: 35,657,299 E899G probably benign Het
Vmn2r109 A G 17: 20,554,580 probably benign Het
Vps53 A G 11: 76,082,659 F170L probably damaging Het
Zc2hc1a G A 3: 7,526,362 S149N possibly damaging Het
Zfp820 A G 17: 21,823,836 probably benign Het
Zhx3 A C 2: 160,780,709 F513V probably damaging Het
Other mutations in Pot1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Pot1b APN 17 55695160 missense possibly damaging 0.94
IGL01796:Pot1b APN 17 55669750 missense possibly damaging 0.53
IGL01810:Pot1b APN 17 55662521 missense possibly damaging 0.68
IGL02371:Pot1b APN 17 55695092 missense possibly damaging 0.91
IGL02553:Pot1b APN 17 55695024 splice site probably benign
IGL02957:Pot1b APN 17 55700009 missense probably damaging 0.99
IGL02975:Pot1b APN 17 55662454 splice site probably benign
IGL03172:Pot1b APN 17 55695206 missense possibly damaging 0.60
boulder UTSW 17 55672865 nonsense probably null
erosion UTSW 17 55687834 missense probably damaging 0.99
G1Funyon:Pot1b UTSW 17 55687895 missense probably benign
R0020:Pot1b UTSW 17 55653429 missense probably benign 0.03
R0540:Pot1b UTSW 17 55665765 missense probably damaging 0.98
R0607:Pot1b UTSW 17 55665765 missense probably damaging 0.98
R1164:Pot1b UTSW 17 55674085 missense probably benign 0.18
R1476:Pot1b UTSW 17 55653451 missense possibly damaging 0.73
R1874:Pot1b UTSW 17 55654805 missense probably benign
R1955:Pot1b UTSW 17 55674067 missense possibly damaging 0.73
R1960:Pot1b UTSW 17 55662531 missense probably damaging 0.99
R1961:Pot1b UTSW 17 55662531 missense probably damaging 0.99
R2109:Pot1b UTSW 17 55653413 missense probably benign 0.00
R2895:Pot1b UTSW 17 55687939 missense probably damaging 0.98
R2943:Pot1b UTSW 17 55674058 missense probably benign
R4681:Pot1b UTSW 17 55654831 missense probably benign 0.28
R4763:Pot1b UTSW 17 55695160 missense possibly damaging 0.94
R4821:Pot1b UTSW 17 55672885 missense possibly damaging 0.73
R5079:Pot1b UTSW 17 55669801 missense probably benign 0.18
R5146:Pot1b UTSW 17 55672865 nonsense probably null
R5176:Pot1b UTSW 17 55699995 missense probably benign 0.05
R5394:Pot1b UTSW 17 55700063 missense probably benign 0.19
R5752:Pot1b UTSW 17 55687834 missense probably damaging 0.99
R6866:Pot1b UTSW 17 55653474 missense possibly damaging 0.83
R8301:Pot1b UTSW 17 55687895 missense probably benign
R8390:Pot1b UTSW 17 55692739 missense probably benign 0.00
R8750:Pot1b UTSW 17 55666537 missense probably benign
RF014:Pot1b UTSW 17 55674106 missense probably benign 0.12
X0062:Pot1b UTSW 17 55695154 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGGCTACAATACCGACAGCTTCAC -3'
(R):5'- TTTACAAGATGCTACAGCTACAGCCC -3'

Sequencing Primer
(F):5'- CCACTGAGTTGATTTTATTACACAGG -3'
(R):5'- CCAGACTGCAAGCTGCAAG -3'
Posted On2013-11-07