Incidental Mutation 'R0928:Cfap70'
ID80686
Institutional Source Beutler Lab
Gene Symbol Cfap70
Ensembl Gene ENSMUSG00000039543
Gene Namecilia and flagella associated protein 70
Synonyms5330402L21Rik, Ttc18
Accession Numbers

NCBI RefSeq: NM_001163638.1, NM_001163639.1, NM_029698.1; MGI: 1923920

Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0928 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location20394193-20452226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 20443919 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 97 (K97N)
Ref Sequence ENSEMBL: ENSMUSP00000022348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022348] [ENSMUST00000022349] [ENSMUST00000056073]
Predicted Effect probably damaging
Transcript: ENSMUST00000022348
AA Change: K97N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022348
Gene: ENSMUSG00000039543
AA Change: K97N

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 581 590 N/A INTRINSIC
Blast:TPR 591 623 2e-11 BLAST
Blast:TPR 624 657 3e-15 BLAST
TPR 658 691 1.73e1 SMART
Blast:TPR 693 724 2e-7 BLAST
TPR 905 938 1.26e1 SMART
TPR 939 972 5.03e-1 SMART
TPR 976 1009 2.52e-1 SMART
TPR 1043 1076 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022349
AA Change: K97N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022349
Gene: ENSMUSG00000039543
AA Change: K97N

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 438 447 N/A INTRINSIC
low complexity region 569 578 N/A INTRINSIC
Blast:TPR 579 611 2e-11 BLAST
Blast:TPR 612 645 3e-15 BLAST
TPR 646 679 1.73e1 SMART
Blast:TPR 681 712 2e-7 BLAST
TPR 932 965 1.26e1 SMART
TPR 966 999 5.03e-1 SMART
TPR 1003 1036 2.52e-1 SMART
TPR 1070 1103 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000056073
AA Change: K97N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056869
Gene: ENSMUSG00000039543
AA Change: K97N

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 625 634 N/A INTRINSIC
Blast:TPR 635 667 2e-11 BLAST
Blast:TPR 668 701 3e-15 BLAST
TPR 702 735 1.73e1 SMART
Blast:TPR 737 768 2e-7 BLAST
TPR 949 982 1.26e1 SMART
TPR 983 1016 5.03e-1 SMART
TPR 1020 1053 2.52e-1 SMART
TPR 1087 1120 2.07e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143940
Predicted Effect probably damaging
Transcript: ENSMUST00000144797
AA Change: K97N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116668
Gene: ENSMUSG00000039543
AA Change: K97N

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
Blast:TPR 640 672 2e-11 BLAST
Blast:TPR 673 706 3e-15 BLAST
TPR 707 740 1.73e1 SMART
Blast:TPR 742 773 2e-7 BLAST
TPR 954 987 1.26e1 SMART
TPR 988 1021 5.03e-1 SMART
TPR 1025 1058 2.52e-1 SMART
TPR 1092 1125 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151077
AA Change: K97N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119023
Gene: ENSMUSG00000039543
AA Change: K97N

DomainStartEndE-ValueType
Blast:C2 11 122 8e-48 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 93.0%
  • 20x: 75.6%
Validation Efficiency
Allele List at MGI

All alleles(17) : Targeted(2) Gene trapped(15)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,582 D745G possibly damaging Het
4931406P16Rik A T 7: 34,248,246 probably null Het
Abca12 T A 1: 71,349,174 D179V probably benign Het
Abcc1 T C 16: 14,389,985 probably null Het
Adad1 G A 3: 37,076,740 probably null Het
Apobec4 T C 1: 152,756,277 Y19H probably damaging Het
Bco2 T A 9: 50,545,931 T104S probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
Ccdc144b A C 3: 36,025,366 N258K possibly damaging Het
Ccs T C 19: 4,825,960 E184G probably damaging Het
Daam2 T C 17: 49,488,227 I313V probably benign Het
Dach1 T C 14: 97,915,832 S467G probably damaging Het
Dnah11 A G 12: 118,045,562 S2122P probably damaging Het
Dnah3 T A 7: 120,030,051 D1427V probably damaging Het
Dnaic1 T C 4: 41,602,566 F97L possibly damaging Het
Dsc1 A T 18: 20,110,249 probably null Het
En2 A T 5: 28,170,331 K291* probably null Het
Eps15 T C 4: 109,312,963 V154A possibly damaging Het
Etnk1 A G 6: 143,184,703 I183V probably benign Het
Fcrlb A T 1: 170,907,940 V255D possibly damaging Het
Fry A T 5: 150,437,084 E52V probably damaging Het
Gm8251 C A 1: 44,057,228 S1570I possibly damaging Het
Gtf2h4 T C 17: 35,670,885 Y152C probably damaging Het
Hao1 C A 2: 134,505,616 L256F possibly damaging Het
Helz T A 11: 107,626,693 I685K probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Izumo2 A T 7: 44,715,423 I171F possibly damaging Het
Krt83 C A 15: 101,491,280 C57F probably benign Het
Mapkbp1 A G 2: 120,015,368 H400R probably benign Het
Megf6 T A 4: 154,177,047 V43E probably damaging Het
Mut T C 17: 40,937,283 I67T probably benign Het
Ninl A T 2: 150,963,475 V396E probably damaging Het
Nvl A T 1: 181,093,902 V844E probably benign Het
Olfr11 C T 13: 21,638,956 C189Y probably damaging Het
P2rx3 A T 2: 85,035,298 M1K probably null Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Ppp3r2 C A 4: 49,681,439 probably null Het
Prmt6 C T 3: 110,250,682 G97D probably damaging Het
Prmt9 T C 8: 77,581,176 V823A probably damaging Het
Skint11 C A 4: 114,244,601 D79E possibly damaging Het
Slc17a8 T A 10: 89,598,683 H194L probably damaging Het
Slco6c1 T A 1: 97,104,848 I293F possibly damaging Het
Tcl1b4 A T 12: 105,202,606 H43L probably benign Het
Tm9sf1 T C 14: 55,636,457 D528G probably damaging Het
Tpbpb C T 13: 60,902,175 V47I probably benign Het
Ttc37 T G 13: 76,113,592 L142W probably damaging Het
Ttn G T 2: 76,907,532 probably benign Het
Usp28 T G 9: 49,030,891 S341A possibly damaging Het
Vwa5a T C 9: 38,728,007 Y345H probably damaging Het
Wdr11 C A 7: 129,606,653 D377E probably damaging Het
Zer1 A G 2: 30,101,763 probably null Het
Other mutations in Cfap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Cfap70 APN 14 20412462 missense possibly damaging 0.77
IGL00567:Cfap70 APN 14 20394680 missense probably benign 0.30
IGL00773:Cfap70 APN 14 20447534 missense probably damaging 1.00
IGL01061:Cfap70 APN 14 20447625 splice site probably benign
IGL01520:Cfap70 APN 14 20420687 missense probably benign 0.23
IGL01665:Cfap70 APN 14 20403118 missense probably damaging 1.00
IGL01918:Cfap70 APN 14 20425399 missense possibly damaging 0.81
IGL02211:Cfap70 APN 14 20394972 missense probably damaging 1.00
IGL02613:Cfap70 APN 14 20409064 splice site probably null
IGL03142:Cfap70 APN 14 20397215 missense probably damaging 0.99
IGL03354:Cfap70 APN 14 20431982 missense probably damaging 1.00
IGL03047:Cfap70 UTSW 14 20448578 missense possibly damaging 0.92
IGL03097:Cfap70 UTSW 14 20448608 missense probably benign 0.00
P0008:Cfap70 UTSW 14 20416532 missense probably damaging 0.99
P0035:Cfap70 UTSW 14 20424471 splice site probably benign
R0200:Cfap70 UTSW 14 20448563 missense probably damaging 0.96
R0207:Cfap70 UTSW 14 20412347 missense probably damaging 1.00
R0238:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0238:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0239:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0239:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0463:Cfap70 UTSW 14 20448563 missense probably damaging 0.96
R0608:Cfap70 UTSW 14 20448563 missense probably damaging 0.96
R0703:Cfap70 UTSW 14 20439715 missense probably damaging 1.00
R0919:Cfap70 UTSW 14 20404164 missense probably benign 0.00
R1595:Cfap70 UTSW 14 20447536 missense probably benign 0.10
R1667:Cfap70 UTSW 14 20404157 missense probably benign 0.41
R1799:Cfap70 UTSW 14 20394999 missense probably damaging 1.00
R1869:Cfap70 UTSW 14 20408610 nonsense probably null
R1920:Cfap70 UTSW 14 20394952 missense probably damaging 1.00
R1968:Cfap70 UTSW 14 20420811 missense possibly damaging 0.93
R2173:Cfap70 UTSW 14 20408562 missense probably benign 0.00
R3081:Cfap70 UTSW 14 20420762 missense probably damaging 1.00
R3813:Cfap70 UTSW 14 20421122 missense possibly damaging 0.95
R3979:Cfap70 UTSW 14 20439719 missense probably benign 0.11
R4093:Cfap70 UTSW 14 20409113 missense probably damaging 1.00
R4271:Cfap70 UTSW 14 20420725 missense probably benign 0.00
R4604:Cfap70 UTSW 14 20443661 missense probably benign 0.01
R4839:Cfap70 UTSW 14 20425529 missense probably damaging 0.96
R6387:Cfap70 UTSW 14 20448575 missense probably damaging 1.00
R6464:Cfap70 UTSW 14 20401039 splice site probably null
R6915:Cfap70 UTSW 14 20409085 missense probably benign 0.17
R7317:Cfap70 UTSW 14 20400434 missense possibly damaging 0.78
R7400:Cfap70 UTSW 14 20408267 missense probably benign
R7962:Cfap70 UTSW 14 20436786 missense probably benign 0.00
R7974:Cfap70 UTSW 14 20420750 missense probably damaging 0.99
R7996:Cfap70 UTSW 14 20409126 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCTGTAAGGTCAAGTTGAGCCAGAG -3'
(R):5'- CCTGGAATCTGAAGCCTCAAGCAAG -3'

Sequencing Primer
(F):5'- ATGGCACAGTCATGTCTTCATC -3'
(R):5'- GCCTCAAGCAAGCGTTC -3'
Posted On2013-11-07