Incidental Mutation 'R0928:Tm9sf1'
ID80688
Institutional Source Beutler Lab
Gene Symbol Tm9sf1
Ensembl Gene ENSMUSG00000002320
Gene Nametransmembrane 9 superfamily member 1
Synonyms1200014D02Rik, MP70
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R0928 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55635965-55643806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55636457 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 528 (D528G)
Ref Sequence ENSEMBL: ENSMUSP00000113782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002391] [ENSMUST00000047131] [ENSMUST00000120041] [ENSMUST00000121791] [ENSMUST00000121937] [ENSMUST00000122358] [ENSMUST00000125133] [ENSMUST00000132338] [ENSMUST00000135221] [ENSMUST00000138085] [ENSMUST00000148351] [ENSMUST00000149726]
Predicted Effect probably damaging
Transcript: ENSMUST00000002391
AA Change: D528G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002391
Gene: ENSMUSG00000002320
AA Change: D528G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047131
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120041
AA Change: D528G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112893
Gene: ENSMUSG00000002320
AA Change: D528G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121791
AA Change: D528G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112764
Gene: ENSMUSG00000002320
AA Change: D528G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121937
AA Change: D511G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113143
Gene: ENSMUSG00000002320
AA Change: D511G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 547 9e-169 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122358
AA Change: D528G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113782
Gene: ENSMUSG00000002320
AA Change: D528G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 58 563 2.3e-164 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130167
Predicted Effect probably benign
Transcript: ENSMUST00000132338
SMART Domains Protein: ENSMUSP00000118427
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 477 9.2e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135221
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138085
SMART Domains Protein: ENSMUSP00000119435
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 172 2.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146588
Predicted Effect probably benign
Transcript: ENSMUST00000148351
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148942
Predicted Effect probably benign
Transcript: ENSMUST00000149726
SMART Domains Protein: ENSMUSP00000115403
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 390 1.7e-103 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150951
Predicted Effect unknown
Transcript: ENSMUST00000156420
AA Change: D64G
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 93.0%
  • 20x: 75.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,582 D745G possibly damaging Het
4931406P16Rik A T 7: 34,248,246 probably null Het
Abca12 T A 1: 71,349,174 D179V probably benign Het
Abcc1 T C 16: 14,389,985 probably null Het
Adad1 G A 3: 37,076,740 probably null Het
Apobec4 T C 1: 152,756,277 Y19H probably damaging Het
Bco2 T A 9: 50,545,931 T104S probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
Ccdc144b A C 3: 36,025,366 N258K possibly damaging Het
Ccs T C 19: 4,825,960 E184G probably damaging Het
Cfap70 T G 14: 20,443,919 K97N probably damaging Het
Daam2 T C 17: 49,488,227 I313V probably benign Het
Dach1 T C 14: 97,915,832 S467G probably damaging Het
Dnah11 A G 12: 118,045,562 S2122P probably damaging Het
Dnah3 T A 7: 120,030,051 D1427V probably damaging Het
Dnaic1 T C 4: 41,602,566 F97L possibly damaging Het
Dsc1 A T 18: 20,110,249 probably null Het
En2 A T 5: 28,170,331 K291* probably null Het
Eps15 T C 4: 109,312,963 V154A possibly damaging Het
Etnk1 A G 6: 143,184,703 I183V probably benign Het
Fcrlb A T 1: 170,907,940 V255D possibly damaging Het
Fry A T 5: 150,437,084 E52V probably damaging Het
Gm8251 C A 1: 44,057,228 S1570I possibly damaging Het
Gtf2h4 T C 17: 35,670,885 Y152C probably damaging Het
Hao1 C A 2: 134,505,616 L256F possibly damaging Het
Helz T A 11: 107,626,693 I685K probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Izumo2 A T 7: 44,715,423 I171F possibly damaging Het
Krt83 C A 15: 101,491,280 C57F probably benign Het
Mapkbp1 A G 2: 120,015,368 H400R probably benign Het
Megf6 T A 4: 154,177,047 V43E probably damaging Het
Mut T C 17: 40,937,283 I67T probably benign Het
Ninl A T 2: 150,963,475 V396E probably damaging Het
Nvl A T 1: 181,093,902 V844E probably benign Het
Olfr11 C T 13: 21,638,956 C189Y probably damaging Het
P2rx3 A T 2: 85,035,298 M1K probably null Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Ppp3r2 C A 4: 49,681,439 probably null Het
Prmt6 C T 3: 110,250,682 G97D probably damaging Het
Prmt9 T C 8: 77,581,176 V823A probably damaging Het
Skint11 C A 4: 114,244,601 D79E possibly damaging Het
Slc17a8 T A 10: 89,598,683 H194L probably damaging Het
Slco6c1 T A 1: 97,104,848 I293F possibly damaging Het
Tcl1b4 A T 12: 105,202,606 H43L probably benign Het
Tpbpb C T 13: 60,902,175 V47I probably benign Het
Ttc37 T G 13: 76,113,592 L142W probably damaging Het
Ttn G T 2: 76,907,532 probably benign Het
Usp28 T G 9: 49,030,891 S341A possibly damaging Het
Vwa5a T C 9: 38,728,007 Y345H probably damaging Het
Wdr11 C A 7: 129,606,653 D377E probably damaging Het
Zer1 A G 2: 30,101,763 probably null Het
Other mutations in Tm9sf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Tm9sf1 APN 14 55642727 missense probably damaging 1.00
IGL01102:Tm9sf1 APN 14 55642767 missense probably damaging 1.00
IGL02263:Tm9sf1 APN 14 55642935 missense possibly damaging 0.95
R0242:Tm9sf1 UTSW 14 55637935 missense possibly damaging 0.90
R0242:Tm9sf1 UTSW 14 55637935 missense possibly damaging 0.90
R0469:Tm9sf1 UTSW 14 55641429 missense possibly damaging 0.87
R0973:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R0973:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R0974:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R1441:Tm9sf1 UTSW 14 55636325 missense probably damaging 1.00
R1644:Tm9sf1 UTSW 14 55641300 missense probably benign 0.03
R1873:Tm9sf1 UTSW 14 55636223 missense probably damaging 1.00
R2176:Tm9sf1 UTSW 14 55641409 missense possibly damaging 0.89
R2973:Tm9sf1 UTSW 14 55641114 missense probably benign 0.01
R4284:Tm9sf1 UTSW 14 55641323 missense probably damaging 1.00
R4545:Tm9sf1 UTSW 14 55638108 missense possibly damaging 0.74
R4633:Tm9sf1 UTSW 14 55641203 missense probably damaging 1.00
R4816:Tm9sf1 UTSW 14 55641149 missense possibly damaging 0.89
R4943:Tm9sf1 UTSW 14 55641168 missense probably damaging 0.99
R5270:Tm9sf1 UTSW 14 55636481 missense probably damaging 1.00
R5384:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R5385:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R5386:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R5561:Tm9sf1 UTSW 14 55638097 missense probably damaging 1.00
R6246:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
R6247:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
R6248:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
R7319:Tm9sf1 UTSW 14 55637975 unclassified probably benign
R7659:Tm9sf1 UTSW 14 55636335 missense probably damaging 1.00
X0025:Tm9sf1 UTSW 14 55642836 missense probably benign 0.43
X0026:Tm9sf1 UTSW 14 55642937 start codon destroyed probably null 0.92
Predicted Primers PCR Primer
(F):5'- TGCCATCACACAATTCGGTCAGAAG -3'
(R):5'- CGTGGAGCTGTACTACATCTTTGCC -3'

Sequencing Primer
(F):5'- GTGGCTTAGAACTCAGTCCATC -3'
(R):5'- ACATCTTTGCCACAGTCTGG -3'
Posted On2013-11-07